Skip to main content

Advertisement

Table 2 Primer combinations used to validate each fimbrial mutation.

From: Analysis of the role of 13 major fimbrial subunits in colonisation of the chicken intestines by Salmonella enterica serovar Enteritidis reveals a role for a novel locus

Primer combination Predicted amplicon size (bp) Sequence (5'-3')
bcfAFOR + C1 633 TGCACTATCCGCAACGATATATTT
bcfAREV + C2 507 TAAAATACGCTTTCGCGATCGGTCGGT
csgAFOR + C2 173 CAAGGAGCAATAAAGTATGCATAATTT
csgAREV + C1 302 CAGCAGTTGTAGTGCAGAAACAGTCGCATA
lpfAFOR + C2 867 TTAGTTACGCGCTGTGTCAA
lpfAREV + C1 288 ATCCAATACCCACCTCTATACACTCCA
fimAFOR +C1 807 AACCTCAGATCGCACCTGCTGC
fimAREV + C2 429 ATGCCGACATGACGCCAGACC
sefAFOR + C1 373 CTATTAATGGGGATGTTGTGTAA
sefAREV + C2 946 CTAATAATCTCTTATAATTTC
safAFOR + C1 701 TGAGACTCTCTCATTGGAGCGCT
safAREV + C2 597 AATTGAGGTCAAGGGTCGCGCC
stbAFOR + C2 887 TTAATGGTGGGGGACATCGTA
stbAREV + C1 295 TTATTTTTACCACTCCATAAGCACGAA
pegAFOR + C2 179 CACAAGCCAGGCATAATGCAATCATC
pegAREV + C1 377 ACATTGCGATAACTTCCTGTCTATGAGAA
stdAFOR + C2 587 GCTGTACCGTACCTGACTGTC
stdAREV + C1 714 TGTTTTTAAATTTCATCCGCGAAG
steAFOR + C1 739 TACGACAACGCCTATATAATA
steAREV + C2 600 AGCAGCGTGGAGTGTCCCAGGTCAGC
stfAFOR + C1 283 CATATAAACATGGGGTATTGATGA
stfAREV + C2 155 GGCTGGCATCATCTTTAACA
sthAFOR + C1 584 GCGTTGATTTTGTTAATGC
sthAREV + C2 704 GAAAGCTCACGATTTGAGATCAAC
stiAFOR + C2 385 TTTGGCCGACAACACACTATG
stiAREV + C1 661 GTAAATCAGCTTAAATTCCG
C1 - TTATACGCAAGGCGACAAGG
C2 - GATCTTCCGTCACAGGTAGG
  1. Primers are specific to the flanking regions of the specified fimbrial gene (FOR or REV) or the chloramphenicol resistance cassette (C1 – forward or C2 – reverse).