Name | Sequence | Origin/use |
---|---|---|
MRG-27 | TAATAACATATGGCGCTGAAGCTTCACTTGAGGGAG | Reverse oligonucleotide for cloning the pstS promoter. The sequence recognized by NdeI is underlined. |
MRG-28 | TTTTTAGATCTCAGCCCCGGGACCGGGCCCT | Forward oligonucleotide for cloning the pstS promoter. It was designed at the end of SCO4143 that is upstream from the pstS gene. The sequence recognized by BglII is underlined. |
MRG-34 | TTTTTCTAGATCAGCTCAGGCCCGAGATGGTC | Reverse oligonucleotide to clone the region of pstS gene that encodes the secreted PstS protein. It contains a XbaI site for cloning. |
RS005 | CCTTCGGCGCCTTCATCTCATC | Forward oligonucleotide of the S. lividans pstS promoter from nucleotide -112 to -91. Used in a PCR to delete the PHO boxes. |
RS007 | GATGAGATGAAGGCGCCGAAGGGGACGGTGCGGTGAGGTCAC | Reverse oligonucleotide to delete the PHO boxes in pstS promoter (from nucleotide -141 to -113). The oligonucleotide contains from nucleotide -161 to -142 and from -112 to -91. |
RS008 | ATCCCCCGGGAGCAACATCAAGTGCGACGACGCC | Forward oligonucleotide to clone the region of pstS gene that encodes the secreted PstS protein. It contains a SmaI site for cloning. |
RS009 | TCCCCCGGGCCACAGGGGTTCACCCGGCG | Forward oligonucleotide of the S. lividans pstS promoter from nucleotide -143 to -124. Used to delete the 186 bp region upstream from the PHO boxes in a PCR with Oli MRG-27. It contains a SmaI site for cloning. |
AE007 | GCCTGGGTCAAGCAGTACGTCG | Forward oligonucleotide of the S. lividans pstS gene from nucleotide +199 to +220. Used in RT-PCR analysis. |
AE008 | GATGGCGCCGGGGGTCTGCTT | Reverse oligonucleotide of S. lividans pstS gene from nucleotide +715 to +735. Used in RT-PCR analysis. |
AE024 | TCGTCGGGCTGGAGATAGGG | Forward of S. lividans phoP gene from nucleotide +254 to +273. Used in RT-PCR analysis. |
AE025 | CGTGGACGTCGAGGGTCTTG | Reverse oligonucleotide of S. lividans phoP gene from nucleotide +561 to +580. Used in RT-PCR analysis. |
16S F | TCACGGAGAGTTTGATCCTGGCTC | Forward oligonucleotide of S. lividans 16S gene from nucleotide +20 to +44. Used in RT-PCR analysis. |
16S R | CCCGAAGGCCGTCATCCCTCACGC | Reverse oligonucleotide of S. lividans 16S gene from nucleotide +436 to +460. Used in RT-PCR analysis. |
MRG-30 | GCCATCGACGCCTGGGTCAAG | Forward oligonucleotide of S. lividans pstS gene from nucleotide +189 to +210. Used to obtain pstS probe for Northern blot analysis. |
MRG-31 | CAGGCCCGAGATGGTCTCGCG | Reverse oligonucleotide of S. lividans pstS gene from nucleotide +1086 to +1107. Used to obtain pstS probe for Northern blot analysis. |