Skip to main content

Advertisement

Table 1 The sequences of DNA sequencing primers

From: Expression of recombinant Clostridium difficile toxin A and B in Bacillus megaterium

   tcdA Sequencing Primers
   Sequence
TcdA-Seq1 Forward CTGCAGCATCTGACATAG
TcdA-Seq2 Forward AAGTTATGAAGCAACATGC
TcdA-Seq3 Forward TCATCTCCATCTATAAGTTCTC
TcdA-Seq4 Forward GTTTCTGGAAATTGTTTGG
TcdA-Seq5 Forward GTTACTGGATGGCAAACC
TcdA-Seq6 Reverse TAGTCCAATAGAGCTAGGTC
TcdA-Seq7 Reverse CCATGTCCAATAAAGGTTAC
TcdA-Seq8 Reverse ACTGCTCCAGTTTCCCAC
TcdA-Seq9 Reverse ACATTTCTACCATTTCCG
TcdA-Seq10 Reverse ATAACCAGTTGAGGCTATG
   tcdB Sequencing Primers
   Sequence
TcdB-Seq1 Forward GAACAAGAGTTGGTAGAAAG
TcdB-Seq2 Forward TCTTGGTGAAGATGATAATC
TcdB-Seq3 Reverse CCTGGTAACATATCAACATC
TcdB-Seq4 Reverse CTCTCTCTGAACTTCTTGC
TcdB-Seq5 Forward CCTACATTATCTGAAGGATTAC
TcdB-Seq6 Forward GATGTTGATAATGTTGTGAGAG
TcdB-Seq7 Forward ATAGTAAGCCTTCATTTGG
TcdB-Seq8 Reverse GCTGCACCTAAACTTACAC
TcdB-Seq9 Reverse ATTACTTCCATTTACCTCAC
TcdB-Seq10 Forward TTATAGAGGAGCTGTAGAATG
TcdB-Seq11 Reverse GCTTTACCTGTTTCTGGG
   Sequencing Primers in pHis-1522 vector
   Sequence
phis-seq-F Forward TTTGTTTATCCACCGAACTAAG
phis-seq-R Reverse TGATTGGCTCCAATTCTTG