Skip to main content

Table 3 Oligonucleotides

From: Transcriptional regulation of subclass 5b fimbriae

NAME SEQUENCE
SN419-Bam GCGGGATCCGACGTCGCAGGAGTAAATCG
SN420-Eco CGCGAATTCGCCTTCGTAACAAAGGG
SN421-Bam GCGGGATCCGACGTCGCAGGAGTGAATCG
SN530-Bam GAGGATCCAAGAACTCGGGGCAGTTC
SN531-Eco GTGAATTCTTTTGATATTGGATAG
SN552-Eco GCTGAATTCATAATACCAAGTCTTACATTAC
SN553-Eco GCAGAATTCCGACCCGCACATTTCCTGTG
SN560-AgeI GTTACCGGTTTATTTGATTGTTGATTG
SN561-AgeI AAACCGGTAACACAAACCAACCATCACAAC
SN562-AgeI GTTACCGGTTTATTTGTTTGTTCATTGTT
SN563-AgeI AAACCGGTAACACATACCGGCCATTACAAC
SN568-KpnI GTCGGTACCTAAATATCATCAAAGACAAGTG
SN569-KpnI TTAGGTACCGATTTACTCCTGCGACGTC
SN570-KpnI GGCGGTACCTAAATGCCACCAAAGGCAAGC
SN571-KpnI TTAGGTACCGCTTTATTCCTGCGACATCA
SN572-SpeI TTACTAGTTTATTTGTTTGTTTATTATTTT
SN573-SpeI AAACTAGTAACACACTCCGGCCATTAC
SN574-KpnI TCGGTACCTAAATATCACCAAAGAC
SN575-KpnI TAGGTACCGATTCACTCCTGCGACGTC
  1. Underlined nucleotides denote primer-template mismatches.
\