Skip to main content

Table 1 Primers used for multiplex PCR to detect and differentiate Salmonella enterica serogroups and serovars

From: Rapid screening of Salmonella entericaserovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles

Target gene1 Nucleotide sequence Expected Size (bp)
O-antigen multiplex   
abe1 (B) F: GGCTTCCGGCTTTATTGG 561
  R: TCTCTTATCTGTTCGCCTGTTG  
wbaD-manC (C1) F: ATTTGCCCAGTTCGGTTTG 341
  R: CCATAACCGACTTCCATTTCC  
abe2 (C2) F: CGTCCTATAACCGAGCCAAC 397
  R: CTGCTTTATCCCTCTCACCG  
prt (A/D1) F: ATGGGAGCGTTTGGGTTC 624
  R: CGCCTCTCCACTACCAACTTC  
wzxwzy (E1) F: GATAGCAACGTTCGGAAATTC 281
  R: CCCAATAGCAATAAACCAAGC  
H1-1 multiplex   
fliC (i) F: AACGAAATCAACAACAACCTGC 508
  R: TAGCCATCTTTACCAGTTCCC  
fliC (g,m) F: GCAGCAGCACCGGATAAAG 309
  R: CATTAACATCCGTCGCGCTAG  
H1-2 multiplex   
fliC (r) F: CCTGCTATTACTGGTGATC 169
  R: GTTGAAGGGAAGCCAGCAG  
fliC (z10) F: GCACTGGCGTTACTCAATCTC 363
  R: GCATCAGCAATACCACTCGC  
H2 multiplex   
fljB (I: 1,2; 1,5; 1,6; 1,7) F: AGAAAGCGTATGATGTGAAA 294
  R: ATTGTGGTTTTAGTTGCGCC  
fljB (II: e,n,x; e,n,z15) F: TAACTGGCGATACATTGACTG 152
  R: TAGCACCGAATGATACAGCC  
  1. 1Indicates the unique genes or the junctions between the two genes used for designing PCR primers. () = antigen(s) detected.