Skip to main content

Table 3 Oligonucleotide primers and TaqMan probes used in RT-qPCR analysis of gene expression

From: Characterization of biofilm matrix, degradation by DNase treatment and evidence of capsule downregulation in Streptococcus pneumoniae clinical isolates

Gene Sequences (5'→3') Source
  Primer Taqman Probe (Fam-Tamra)  
CpsA F: CTTTGCAGTACAGCAGTTTGTTG ACTGACCAATCGTTTAAATG Ref. [25]
  R: TCTGCTAAAACAGCGACACTGA   
gyrB* F: CCAAACCGACTATTCAGCGTTAT TGAAATGGACGATCATCAGCTGTGGGA In this study
  R: TGTTCGGGATCCATGGTTGT   
  1. *gyrB was used as endogenous control.