Skip to main content

Table 5 Primers for amplifying exogenous DNA sequences of selected representative phages

From: Evolutional selection of a combinatorial phage library displaying randomly-rearranged various single domains of immunoglobulin (Ig)-binding proteins (IBPs) with four kinds of Ig molecules

Name Description Sequence (5' → 3')
5SNco-u Forward amplifying primer TATCCATGG*CTGCGGCCCAGCCGGCCTCT
5SNoG-d Reverse amplifying primer CCTGCGGCCGCAACTGCCGCCGCC
B-S-U Forward sequencing prime GGA TCC GAG CTC AGG CCT GTC GAC GGT ACC GTT
  1. *: Underlined part represents Nco I recognition site.