Skip to main content

Table 3 Primers designed in this study.

From: Short tandem repeat sequences in the Mycoplasma genitaliumgenome and their use in a multilocus genotyping system

Primer name Sequence (5'→3') Target
185F1 CAACTGCACGCTTTCCCTAT MG185
185R1 CCTCTCTTTCATTTGCATGG MG185
185R2 GCGTTGGGGTGCTTTTAGAAC MG185
307F6 TGACCATTATCGCTTCATTT MG307
307R3 AGTTGTTGGGTGCCTGTAT MG307
307F5 GTAACAACACCAATAATCCTCAG MG307
307R4 TTGGTTGGTTTGGGTACTTC MG307
338F1 GGTGGTCAAACAAACTCTGC MG338
338R5 CCTCCATCAATATGAAATGC MG338
338F4 AAGTATAGTGCAAGCAAAGT MG338
338R4 CTTGTTACTACTTGTGCTTGAGATG MG338
ITS1-107R CTGACCAAATGTGTTAGTTGTGAG ITS1