Skip to main content

Table 2 Primers used in this study

From: Spx mediates oxidative stress regulation of the methionine sulfoxide reductases operon in Bacillus subtilis

Primer Name Sequence (5'-3')
CHY13 GATAAACCCAGCGAACCATTTGAGGTG
CHY14 GATACAAATTCCTCGTAGGCGCTCGGGAC
CHY45 CCGGAATTCGAAATCGCCACATTTGCAGG
CHY46 CGCGGATCCTTATTTAGCCCCCCAATGCTCG
CHY101 AAGCCCATATTGCTCGAGGTGG
CHY102 TATCACCTCAAATGGTTCGCTGGGTTTATCCAGCTTGGTGATGTGTATAGTG
CHY103 GGTCCCGAGCGCCTACGAGGAATTTGTATCAGAAGCACAGCGTTTGGCAAAC
CHY104 GGAACATTTATTGCCGTTGCC
CHY109 AAGGAGGAAGCAGGTATGGTTACACTATACACATC
CHY110 GACACGCACGAGGTTTAGTTTGCCAAACGCTGTG
CHY111 CTCGCCTTTCTGCATGAAGTCGCGCTTGGTGATGTGTATAGTG
CHY112 CACCAAGCGCGACTTCATGCAGAAAGGCGAG
CHY113 GAGCCACGCTCTCGCCTTTCTCGCTGAAGTACAGCTTGGTGATG
CHY114 ACTTCAGCGAGAAAGGCGAGAGCGTGGCTC
CHY115 GAGCCACGCTCTCGCCTTTCTCGCTGAAGTCGCGCTTGGTGATGTGTATAGTG
CHY128 GTCTGCAAATGCAAGGCATG
CHY129 TATCACCTCAAATGGTTCGCTGGGTTTATCCAGCTACAAGCTTACGAACCTG
CHY130 GGTCCCGAGCGCCTACGAGGAATTTGTATCGCAACTGTGACACACGGAGAG
CHY131 AGTTCCACAAAGACAGCCTG
CHY134 CGGCCATACTGAAAACCCTA
CHY135 ATCTGTCGGATCGATTTGCT
CHY137 GCAGTAACGAAGTCCGTTTG
CHY140 CCGCATGGTTCAAACATAAA
CHY141 CGTCAGACTTTCGTCCATTG
CHY173 CCACTTCTTCTTCAATCGGC
CHY253 GGACTAGTAGAGGAGTGAAGATGAATGG
CHY254 CGCGGATCCTTAAGCGTAATCCGGAACATCGTATGGGTAGTTTGCCAAACGCTGTGCTTC
YGSP3 TTTCCGCCAGACGTTGCTTG
YGSP4 GCATCTGTCGGATCGATTTG