Skip to main content

Table 1 Oligonucleotides used for qPCR

From: Differential expression of lipoprotein genes in Mycoplasma pneumoniae after contact with human lung epithelial cells, and under oxidative and acidic stress

Family Gene annotation (NCBI) Forward primer Reverse primer
HKGa MPN430 GACGTATTGGACGCCTTGTT GTCGTTAACGGCAACGATCT
HKG MPN665 GGCAAGAACACCCCTATT TAGGATCACCTTCAAGCG
HKG MPN003 GGGGAAGTGATTGGTGAT TTGGTACCGTGTTCCTTG
1 MPN084 AACCCATTTCTTTGCATTGG GTTTTGGGGATTGCTGATGT
  MPN591 ACACAACTGTGGGAATGCAA CCCTGCCTTAGGTTTTTGGT
  MPN592 TGCTTGCTCTGCTACGCTAA GCTCAATGGTGGTTGAGGTT
  MPN083 ACCAACGGTTTTTGAACAGC GCATCATTGGGGTTGGATAG
  MPN588 AAAGCCTTGGTTTCGATTCA TGCCAGGAAGACTTGTTGTG
  MPN582 TGTGCGAACCGTTGATTTTA CTAATTTGCTTGGTGCGACA
2 MPN199 AGTTTCCGCTAGTTCGTTGC GTTTTTGCGGCATCTTCAAT
  MPN408 ATTCCCATTTCCCTTTCCAC CATTTGAGCACCGTTTTCCT
  MPN200 TTCCGGTCTCTGTTTCGACT TCTTTTTGTGCGCCCTTACT
  MPN152 CGATTAATGGACCCGTTTTG TCTTTGCACCGAAGTGACAG
3 MPN436 CCCAGTCAAGGGTTAGGTCA TCTTCGGCAAAGAAAGGAAA
  MPN444 AACCGAAGTCAAAAACCC GAAGTGTCATCAGCAGCC
  MPN489 GATGGTAGTTACCCCGCT ACTAAAGCGGCAGATCCT
4 MPN456 AGCTGCACAAAGAAGCAC CTTGAGTGCCGTTACCAC
5 MPN011 AAAGGCATTAGCGATGTTTCA AATGTTTGTCACCTTTGTGGA
  MPN012 AGAGTGCGGAAAAAGGTGAA AAAGGATCATTGCCTGTTGC
  MPN411 GGTATTGCGGAACTTGCTTT TCAACTTTCCGCTCCATTTT
  MPN271 TGCGGATTTTGATTTTGACC GATCAACCTTTCGCTCCATC
  MPN505 TTTGAAAAGGGCGAATTAGG TGATCAACCTTTCGCTCAAA
6 MPN647 ATGGATCCTTCCCGTTTTTC CCGGGATAAGTTTCTGCAAG
  MPN646 TGAACTGGGCGATAAGGAAG AACAAATTTGAAGCAGGTGGA
  MPN645 TGGCGGAGTAAAAGAAACTGA TCAAAAGAAGTGGCACCAAA
  MPN644 GGAGTGCAAAGCCAAAAAGT CTTCACCACTGCCAACAATG
  MPN643 TGGCAGAAGCATTGAAGATG TGTGTGTATCTTTCCACCAAGC
  MPN642 CCACATAAAGATGGAAGGGATG TCCAGTATATTCACTTTCTTCTACGC
  MPN641 TCAATTGAGGGAAGGCGTTA TGCAGTGACTCCACAAAAGC
  MPN640 TTCGGGAGGTAAAGGTAGCA TGAATTTGGCTTTTTCACCA
  MPN639 CGCGAAAGTTACGGCTTAAA AAGCGGCCTACTTCAGTTTG
  1. a housekeeping gene