Skip to main content

Table 4 Oligonucleotides used in this study

From: Hepatitis B virus genotypes and resistance mutations in patients under long term lamivudine therapy: characterization of genotype G in Brazil

PCR round Name Sequence and position Fragment size (bp)
Nucleotide sequencing of complete genomes
  S2 (antisense) GGGTTTAAATGTATACCCAAAGA, 841–819  
2nd PS1 (sense) CCATATTCTTGGGAACAAGA, 2826–2845 1236
  S2 (antisense) GGGTTTAAATGTATACCCAAAGA, 841–819  
2nd C5 (sense) AGACCACCAAATGCCCCTATC, 2299–2319 703
  PS3 (antisense) TCCTTGTTGGGATTGAAGTCCCA, 3002–2980  
1st PS1 (sense) CCATATTCTTGGGAACAAGA, 2826–2845 1753
  X3 (antisense) AGCAGCCATGGAAAGGAGGT, 1383–1363  
2nd S18 (sense) GGATGATGTGGTATTGGGGGCCA, 743–765 648
  X3 (antisense) AGCAGCCATGGAAAGGAGGT, 1383–1363  
1st S18 (sense) GGATGATGTGGTATTGGGGGCCA, 743–765 1724
  C2 (antisense) CTAACATTGAGATTCCCGAGATTGAGA, 2458–2432  
2nd X1 (sense) ACCTCCTTTCCATGGCTGCT, 1363–1383 712
  C3 (antisense) TTGCCTGAGTGCAGTATGGT, 2056–2075  
2nd PC1 (sense) GGCTGTAGGCATAAATTGGTCTG, 1781–1803 667
  C2 (antisense) CTAACATTGAGATTCCCGAGATTGAGA, 2458–2432  
Other sequencing and PCR-RFLP experiments
1st PS1 CCATATTCTTGGGAACAAGA, 2826–2845 1236
2nd PS1 CCATATTCTTGGGAACAAGA, 2826–2845 1099