Skip to main content

Table 2 Primers, their target, sequence, primer pairings and predicted amplicon size of primer pair.

From: IS1111 insertion sequences of Coxiella burnetii: characterization and use for repetitive element PCR-based differentiation of Coxiella burnetii isolates

Target Primer name Sequence (5' to 3') Paired primer set and predicted amplicon size
Conserved for each IS element IS1111-1 ACTGCGTTGGGATACCCATC NAa
IS1 IS1 TAATGGGCGACCAAGTCGA IS1111-1; 501 bp
IS2 IS2 GGCTGAATGAATGCCTTCCA IS1111-1; 501 bp
IS3 IS3 AAAAAGACCCTTCAGGTAATGGAA IS1111-1; 477 bp
IS4 IS4 TTCCGCCATGACCAACTTC IS1111-1; 519 bp
IS5 IS5 GTCGGTCAACGTCGTCACAT IS1111-1; 515 bp
  556F AACCGTGGCTGAGCGATC IS5; NA
IS6 IS6 CCATTTGCAATAGCCGTGAA IS1111-1; 477 bp
IS7 IS7 GCGGTTTTGGTACAATACTGTCATT IS1111-1; 571 bp
  1091F TGCAGGACATATTGTTGATGTCAC IS7; NA
IS8 IS8 GGCAAGGATGACGAATGGAT IS1111-1; 471 bp
IS9 IS9 GCCTCAGCCGATTTCGAG IS1111-1; 492 bp
  1219F CCCGAAGGTATCCATAACTCTGG IS9; NA
IS10 IS10 GTGCGGCATTCGTGGTAGA IS1111-1; 481 bp
  1269R GATTTCCATCGACGTCCGC 1273R; NA
  1273R TTCAGTTTATAGCGGCAGGACC IS1111-1; NA
IS11 IS11 AAAGCCGTTCCCTACCGTG IS1111-1; 481 bp
IS12 IS12 ACGTAGTTTGGAAAGGATACCCG IS1111-1; 482 bp
IS13 IS13 GATGAGCGTCCACCACTGAA IS1111-1; 537 bp
IS14 IS14 TGCTACCAACAGACTTACGGCA IS1111-1; 481 bp
  1701R TAAACACGAGGCGCTAGGTCA IS14; NA
IS15 IS15 AACGCCCATGTGAGAAACATC IS1111-1; 531 bp
  1718F ACGGGTGTTCAAGCAGCC IS15; NA
IS16 IS16 ATGACTTCTGATAGGGACTGTGCTC IS1111-1; 511 bp
  1761F GCCGTTGATCTTGCCGATAA IS16; NA
IS17 IS17 CGAATCGCATTGGCACAGT IS1111-1; 477 bp
IS18 IS18 CGTTTGCTGCTATACGACATGAA IS1111-1; 532 bp
IS19 IS19 GTCGCCCAGGAGTGTTTCTG IS1111-1; 531 bp
  1960R ACAAAGACGACTCAGTTCGGC 1963R; NA
  1963R CGATGTCTGCCTTTAGGAGGTC 1960R; NA
  1963R-seq GTAGAAAGAGTCTCTCTTG NA
IS20 IS20 ACGTCAATTACATCGAGCATTCA IS1111-1; 470 bp
  1987F AGGGCCATCTTGACCTGGA 1993F; NA
  1993F CGCACTGAGCGCATTGAC 1987F; NA
  1. aNot applicable