Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: Classification of a moderately oxygen-tolerant isolate from baby faeces as Bifidobacterium thermophilum

Primer Sequence (5'-3')
lm3 CGGGTGCTICCCACTTTCATG [42]
lm26 GATTCTGGCTCAGGATGAACG [42]
520F CAGGAGTGCCAGCAGCCGCGG [25]
520R ACCGCGGCTGCTGGC [25]
1100F CAGGAGCAACGAGCGCAACCC [25]
1100R AGGGTTGCGCTCGTT [25]
H60F GGNGAYGGNACNACNACNGCNACNG [34]
H60R TCNCCRAANCCNGGNGCYTTNACNGC [34]
T7 TAATACGACTCACTATAGG [Promega]
SP6 ATTTAGGTGACACTATAG [Promega]