Skip to main content

Table 6 Sequences of primers (5’ to 3’) used to amplify ure genes

From: Brucella suis urease encoded by ure 1 but not ure 2 is necessary for intestinal infection of BALB/c mice

Primer name Sequence (5' to 3')
UreaseONE-Forward CGACGCCGTAGGTAAATC
UreaseONE-Reverse TGAAATGGACATGGGTATCG
UreaseTWO-Forward GCTTGCCCTTGAATTCCTTTGTGG
UreaseTWO-Reverse ATCTGCGAATTTGCCGGACTCTAT
Ure-2-AB-Forward CGGGGATCCCATCACAATCGGCAAACA
Ure-2-AB-reverse CGGTCTAGAATGGCGCGAAGGAAGGTT 3'