Skip to main content

Advertisement

Table 1 Oligonucleotide sequences used for the amplification and sequencing of nine genetic loci.

From: Characterisation of the genetic diversity of Brucella by multilocus sequencing

Locus Putative function Primer sequences Length   Location1
gap glyceraldehydes 3-phosphate dehydrogenase 5' YGCCAAGCGCGTCATCGT 3' 5' GCGGYTGGAGAAGCCCCA 3' 589 bp AE017223 1685083–1685671
aroA 3-phosphoshikimate 1-carboxyvinyltransferase 5' GACCATCGACGTGCCGGG 3' 5' YCATCAKGCCCATGAATTC 3' 565 bp AE017223 29974–30538
glk glucokinase 5' TATGGAAMAGATCGGCGG 3' 5' GGGCCTTGTCCTCGAAGG 3' 475 bp AE017224 988660–989134
dnaK chaperone protein 5' CGTCTGGTCGAATATCTGG 3' 5' GCGTTTCAATGCCGAGCGA 3' 470 bp AE017223 2066742–2067211
gyrB DNA gyrase B subunit 5' ATGATTTCATCCGATCAGGT 3' 5' CTGTGCCGTTGCATTGTC 3' 469 bp AE017223 142378–141910
trpE anthranilate synthase 5' GCGCGCMTGGTATGGCG 3' 5' CKCSCCGCCATAGGCTTC 3' 486 bp AE017223 1538194–1537709
cobQ cobyric acid synthase 5' GCGGGTTTCAAATGCTTGGA 3' 5' GGCGTCAATCATGCCAGC 3' 422 bp AE017223 1289341–1288920
omp25 25 kDa outer-membrane protein 5' ATGCGCACTCTTAAGTCTC 3' 5' GCCSAGGATGTTGTCCGT 3' 490 bp AE017223 710041–710530
int-hyp upstream and extreme 5' of hypothetical protein (BruAb1_1395) 5' CAACTACTCTGTTGACCCGA 3' 5' GCAGCATCATAGCGACGGA 3' 430 bp AE017223 1372708–1372279
  1. 1Location in B. abortus 9–941 genome sequence.