Skip to main content

Table 2 Primers used in this study*.

From: No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus

Name Position Sequence Use
SA-hfq 5up (BamH1) F 5'CGGGATCC ATGACGATTCTTTAGGTGA3' Used for cloning upstream region of hfq
SA-hfq 5down (KpnI) R 5'GGGGTACC TGTCGGACTCCTTTTACT3'  
SA-hfq 3up (SmaI) F 5'TCCCCCGGG ATGGGCACGATTTAATGAC3' Used for cloning downstream region of hfq
SA-hfq 3down (EcoRI) R 5'CGGAATTC TACTTGAAACACCTGATT  
SA-cat 5 (KpnI) F 5'GGGGTACC GCACAGACAGGACAAAATCG Used for cat amplification
SA-cat 3 (SmaI) R 5'TCCCCCGGG TTCCGAGGCTCAACGTC3'  
SA-hfq verif up F 5'ATCATAGCAGGTGGAACAG3' Used for verification of hfq deletion
SA-hfq verif down R 5'CGAAAGAGAAATAGAAAAAT3'  
SA-RNAIII 5 F 5'CAGAGATGTGATGGAAAATAGTTG3' Used for RNA III probe amplification
SA-RNAIII 3 R 5'ATTAAGGGAATGTTTTACAGTTATT3'  
SA-spa 5 F 5'TTAGCATCTGCATGGTTTGC3' Used for spa probe amplification
SA-spa 3 R 5'ACAACGTAACGGCTTCATCC3'  
SA-hu 5 F 5'AGATTTAATCAATGCAGTTGCAGA3' Used for hu probe amplification
SA-hu 3 R 5'AATGCTTTACCAGCTTTG AATGCT3'  
SA-hfq 5 (NdeI) F 5'GGAATTCCATATG ATTGCAAACGAAAAC3' Used for hfq probe amplification, RT-PCR
SA-hfq 3 (HindIII) R 5'CCCAAGCTT ATTCTTCACTTTCAGTAG3'  
  1. *F: forward; R: reverse. Restriction enzyme sites are underlined.