Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: Identification of transposon insertion mutants of Francisella tularensis tularensis strain Schu S4 deficient in intracellular replication in the hepatic cell line HepG2

Name Sequence (5'-3') Source
SqFP GCCAACGACTACGCACTAGCCAAC Epicentre
SqRP GAGCCAATATGCGAGAACACCCGAGAA Epicentre
5'RParr-2 TAAGGAGGTATCATATGGTAAAAG D. Wood1
3'RParr-2 GTCTAGAGGATCCTTAATCTTC D. Wood1
BM007 GTTGGCTAGTGCGTAGTCGTTGGC This study
BM008 GTTGGCTAGTGCGTAGTCGTTGGC This study
BM009 CGTTAAACATGAGAGCTTAGTACG This study