Skip to main content

Table 1 Primers Used in PCR screening of Phage Genes and Phage Excision Products

From: The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

    Primer PCR product Location
Primer Name ORF/gene product Sequence 5' to 3' Length Size (bp)  
ORF01192Fa BA0479-hypothetical AAACCCTGGGACCTCTGAAC 20 1002 prophage 04
ORF01192Ra BA0479-hypothetical GGAAGAATCGCACGACCATC 20   prophage 04
ORF02190Fa BA5356-Terminase, large subunit GACATCGTTGCACCTTCACAAG 22 1462 prophage 03
ORF02190Ra BA5356-Terminase, large subunit CCAAATGTCGAGCATCTTGTTC 22   prophage 03
ORF03655 Fb BA4094-Terminase, large subunit TTGATCGATCCATCTCCTGAAC 22 1192 prophage 02
ORF03655 Rb BA4094-Terminase, large subunit GATCAACTTTAGCCTGCGGAAC 22   prophage 02
Ba02 #7 Forc BA4094-Terminase, large subunit CAAAGACAGATCCACCTGGAC 21 304 prophage 02
Ba02#7 Revc BA4094-Terminase, large subunit CAAAGGGAGGTTCAGCATCTC 21   prophage 02
ORF03991 Fa BA3805-Acyl transferase AGTTGCATGCCCAGTTCTTG 20 1205 prophage 01
ORF03991 Ra BA3805-Acyl transferase CTGCGTGACTGGAATCCCTTAC 22   prophage 01
Ba04INF LambdaBa04 left junction CCAGTTGAATCCAGAACAAACG 22 871 prophage 04
Ba04OUTR LambdaBa04 left junction GGGCAGTCATACGAGGATAATG 22 (961,865)d prophage 04
Ba04OUTF LambdaBa04 right junction CCTTCGCTTTGAATTCCTTCTC 22 997 prophage 04
Ba04INR LambdaBa04 left junction GAATTGTAACGAGCATGGAAGC 22   prophage 04
Ba03INF LambdaBa03 left junction ACGTTACCCCTATTTCCGAAGC 22 938 prophage 03
Ba03OUTR LambdaBa03 left junction CATTTTAATGCGCCCACGAC 20 (923, 952)d prophage 03
Ba03OUTF LambdaBa03 right junction TTCCACATCTTCCTTCAGCAAC 22 977 prophage 03
Ba03INR LambdaBa03 left junction GGCCGTACTGGCTTAACTTCTG 22   prophage 03
Ba02INF LambdaBa02 left junction TCACTTGCCAGTCTTGACCTTG 22 891 prophage 02
Ba02OUTR LambdaBa02 left junction GGTGCATAAGGCGGTAAAGATG 22 (861,962)d prophage 02
Ba02OUTF LambdaBa02 right junction GGCGAGGTATTAGCTTTACAGTGG 24 976 prophage 02
Ba02INR LambdaBa02 left junction GTCCATCTTCACTGCCGAAAC 21   prophage 02
Ba011NF LambdaBa01 left junction ACAAATTCAGTTGCGCTTCC 20 1053 prophage 01
Ba010UTR LambdaBa01 left junction TGCAGCACCTACACTGAAACAAG 23 (878, 1047)d prophage 01
Ba010UTF LambdaBa01 right junction CGATGGAAAGTTCTTACCGAAG 22 915 prophage 01
Ba011NR LambdaBa01 left junction ATGATGCTCGTCACTTCATCG 21   prophage 01
gmk F BC guanylate kinase, putative ATTTAAGTGAGGAAGGGTAGG 21 500 chr
gmk R BC guanylate kinase, putative GCAATGTTCACCAACCACAA 20   chr
PA1 For Protective antigen ATCACCAGAGGCAAGACACC 20 311 pXO1
PA1 Rev Protective antigen CCATTGTTTCAGCCCAAGTT 20   pXO1
bla F Amp resistance TTACCAATGCTTAATCAGTGAGGC 24 861 plasmid
bla R Amp resistance ATGAGTATTCAACATTTCCGTGTC 24   plasmid
Primers Used in Real Time PCR for determination of Phage Excision Frequencies      
Bce_glpR BC glycerol kinase GCAGTAGCGGTTGCAGCATA 20 150 chr
Bce_glpF BC glycerol kinase CCCGATAATTGCCCCAATC 19   chr
Ba04circF LambdaBa04 circle junction TCAAACCCATCAACAATTTCATTG 24 129 Extra-chr
Ba04circR LambdaBa04circle junction CAATAGAATGCACAACAGTGACATAAGT 28   Extra-chr
Ba03circF LambdaBa03 circle junction CAAGGGTTGTAGCTGATAGCTCATT 25 170 Extra-chr
Ba03circR LambdaBa03 circle junction TGACAAAGTTCAGTCGATTTTTTTCT 26   Extra-chr
Ba02circR LambdaBa02 circle junction GACCACAACTTGTACCACATTTATTATTT 29 166 Extra-chr
Ba02circF LambdaBa02 circle junction CCGCAATATAGGTGGTATAATGCA 24   Extra-chr
Ba01circF LambdaBa01 circle junction CCCACAAAATAAAAAAACCCTCAA 24 150 Extra-chr
Ba01circR LambdaBa01 circle junction ACGTTTTTGGCGCAATTTAAA 21   Extra-chr
Ba04mtF LambdaBa04 deleted junction AGCACGTGATGTACAAGCGTTAA 23 150 φ free chr
Ba04mtR LambdaBa04 deleted junction TATTCCCTCATATCATGAGGGAATATG 27   φ free chr
Ba03mtF LambdaBa03 deleted junction TGGCCAAATCAAAACTGGTTCT 22 165 φ free chr
Ba03mtR LambdaBa03 deleted junction TTCTCACGGTCTGTCGTTATTTTC 24   φ free chr
Ba02mtF LambdaBa02 deleted junction ATATCACCTCAAGGCAACAAACAA 24 150 φ free chr
Ba02mtR LambdaBa02 deleted junction GGTAATCTCTCCTTTCGATGTAGCA 25   φ free chr
Ba01mtF LambdaBa01 deleted junction CATTAGGAGATCACTTACTTGAGCACTT 28 161 φ free chr
Ba01mtR LambdaBa01 deleted junction CACAAATAAAAAAACCTTGATACCGTAGT 29   φ free chr
Primers Used in Real time PCR screening of Prophage Genes    Primer PCR product Location
Ba04-RT-F BA0479-hypothetical TATAATGGGCACTCCATTTTGGT 23 150 prophage 04
Ba04-RT-R BA0479-hypothetical TCCACAGTGGCATTTACCTTTG 22   prophage 04
Ba03-RT-F BA5356-Terminase, large subunit TCCTATCGAGAATGGGTTCAACTAT 25 150 prophage 03
Ba03-RT-R BA5356-Terminase, large subunit GCGTCCCTACCGTTCAACTG 20   prophage 03
Ba02-RT-F BA4094-Terminase, large subunit TGCGTTTTATCATGGAAAATGC 22 150 prophage 02
Ba02-RT-R BA4094-Terminase, large subunit TGAGCCAGGTGCTCGTGTT 19   prophage 02
Ba01-RT-F BA3805-Acyl transferase CACTTGAATCAACTGGTATCGTGAA 25 150 prophage 01
Ba01-RT-R BA3805-Acyl transferase AAATCCAAATTGAGGCATATGATGA 25   prophage 01
  1. asimplex and multiplex; bsimplex only; cmultiplex only; dsizes of PCR products of phage circle and phage excised chromosomal junction respectively