Skip to main content

Table 1 Oligonucleotides used as PCR primers.

From: Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species

name sequence (reference)
cytup 5'-TAACGATACCGCTCACAAGGG-3'
dedAup 5'-GTCAAATCTTCGGGAATCGG-3'
NM10 [42]
NM11 CCGCCGCCACGCTGCCGTGT
NM7 TTGGCAGGCAGGACGGTTTG
NmAsmup 5'-CATATTTCAGACGGTATTTGTGG-3'
NmdusCrev CCTTTTCAGACGGC ATGAAGTATGTGAACC
Nmdusfwd GTTTTTTATTTTGGGAGGAGTTC
NmdusTrev CCTTTTCAGACG AC ATGAAGTATGTGAACC
NmdusXrev CCTTTT GTGA GTGC ATGAAGTATGTGAACC
Nsfcytokrom1 5'-TATCGCGCAAGGCTTCGATAC-3'
Nsfcytokrom2 5'-TAACGCCATGCCTGCAAAAG-3'
Nsfcytokrom3 5'-AGAAACCCTGCACAAACACG-3
Nsfcytokrom5 5'-AACGCCATGCCTGCAAAAG-3'
Nsfdownsense3 5'-CAGGTTTCCCGCTGTTGATCG-3'
Nsfmutasdown2 5'-TGCGCATCCAAAAAGGTCAG-3'
Nsfmutasdown3 5'-AAAGACGTGTTGGCGGAAGTG-3'
Nsfmutasdown4 5'-GGGAACGGTGGTACAGTGGAT-3'
Nsfmutasdown5 5'-CCATGCCGGTTTAAGGTTAAT-3'
Nsfmutasfwd6 TATTCCGACAACGGCATCAAATTC
Nsfmutasfwd7 5'-GTGAAGCTGAGCGATGAAATCGAG-3'
Nsfmutasrev5 5'-GTCGATTTTGGCTTCGATTTCC-3'
NsftyrBdown1 5'-GATTGAGCGTGGAACAAGTCCG-3'
NsftyrBdown2 5'-ATTCCGGCAGGATGTGCGTC-3'
NsftyrBfwd1 5'-ACCGGCGTGGATATGTCGG-3'
NsftyrBup 5'-GGTCGTTTTTGAAGGTTTCGAC-3'
Nsfupanti 5'-GTTTGGGCGTTTTGCGAATA-3'