Skip to main content

Advertisement

Table 2 Primers and probes for real-time PCR

From: Effect of iron on the expression of sirR and sitABC in biofilm-associated Staphylococcus epidermidis

Gene Forward primer 5'-...-3' probe: labeled FAM-5'and 3'-TAMRA Reverse primer 5'-...-3'
gmk AAGGTGCTAAGCAAGTAAGAAAGAAATT ATGCGTTGTTCATATTTTTAGCGCCTCCA CAACAAGACGTTCTTTCAAGTCATCT
sirR AATATCAAACCACCATCAGTAAGTGAA AGGGCGTTTAGAAAAGGAAGGCTATGTTGAA ACGGGCACCTTTATAATGTTTTGT
sitC CATTAACAGATGCTGACGTTGTATTTT AACTGGAAATGGTTGGTTTGAAAAAGCACTTG CCTTCCTCACCATTTAAAGTATATTGG
sitB TTTGTCATGTTATTACTCGCACTTGTA CTGTTGCGAGCATACAAACAGTTGGAATTATCC AGCTGTAGAAGCTGGAGTGATTAGTAAA
sitA TGCAGAATTAAGTGGTGGACAATT AACGTGTTCTTGTTGCAAGAGCACTTATGAGTAATAGT CCAACAAAAGGTTCGTCTAAACAAT