Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

Primers for the sequencing of ggt and ggh genes, and RT-PCR (for ggt-9 and ggt-10)
Oligonucleotide name Position in sequence Length (bp) Sequence (5'-3') Reference
ggt-3 *1265–1286 21 GACTGCTGATGACATTAGCGG [49]
ggt-4 *3250–3228 22 GATTACTCACAATTTCCCCCTA [49]
ggt-5 *1791–1811 20 CGATGCGTGCGACGCCGGAA [25]
ggt-6 *2676–2654 23 ATAGCACATTGCCCGCCTTATCC [25]
ggt-7 *2241–2262 22 CAAGATTTATCTGATTATCAAG [25]
ggt-9 *2779–2800 21 GGGCAAACAGGTCGCCAATCG [25]
ggt-10 *2089–2068 21 TGTAGCGGCACACCATTCGGC [25]
ggt-18 *1554–1534 21 CGGTCAGTCCCGTTGCATGTT [25]
Primers for RT-PCR
ggt-29 *1452–1475 24 GGATGTCAAGTCATCCATGCCAAT This study
ggt-20 *1682–1659 24 TGTCGTCTGCACCGCCACCATCGC This study
ggt-31 *1878–1901 24 GGTACGCCTGCTATCCCTAAACTG This study
ggt-22 *3079–3056 24 CGCACATCAGTCTTATAGCCCAAA This study
Primer for primer extension
primer-ext-2 *1492–1467 26 GTATTAACCTTACCTTGATTGGCATG (Biotin-labeled at the 5'-terminus) This study
  1. *Numbers of positions indicate the position from the 5'-nucleotide of the ggt locus in N. meningitidis strain H44/76 [DDBJ:AB175033].