Skip to main content

Table 3 Primer sequences, gene targets and expected product sizes for viruses on the molecular strip.

From: A touchdown nucleic acid amplification protocol as an alternative to culture backup for immunofluorescence in the routine diagnosis of acute viral respiratory tract infections

Name Sequence (5' to 3') Gene Target 1st/2nd Size (bp)
PF1 1A CCT TAA ATT CAG ATA TGT AT HN1 1 478
PF1 1B GAT AAA TAA TTA TTG ATA CG    
PF1 1C CCG GTA ATT TCT CAT ACC TAT G   2 317
PF1 1D CCT TGG AGC CGA GTT GTT AAG    
PF2 1A AAC AAT CTG CTG CAG CAT TT HN1 1 508
PF2 1B ATG TCA GAC AAT GGG CAA AT    
PF2 1C CCA TTT ACC TAA GTG ATG GAA T   2 204
PF2 1D GCC CTG TTG TAT TTG GAA GAG A    
PF3 2A CTTG TAA ACT CAG ACT TGG TA HN1 1 478
PF3 2B TTT AAG CCC TTG TCA ACA AC    
PF3 2C ACT CCC AAA GTT GAT GAA AGA T   2 103
PF3 2D TAA ATC TTG TTG TTG AGA TTG    
hMPV 1A GCG GCA ATT TTC AGA CAA CG Fusion 1 696
hMPV 1B ACA TGC TGT TCG CCT TCA AC    
hMPV 1C CAG CAG CAG GAA TCA ATG TT   2 288
hMPV 1D TCG CCT TCA ACT TTG CTT AG    
CoV229E 1A GGT ACT CCT AAG CCT TCT C G Nucleocapsid 1 450
CoV229E 1B TGC ACT AGG GTT AAG AAG AGG    
CoV229E 1C TTT GGA AGT GCA GGT GTT GTG G   2 100
CoV229E 1D GAC TAT CAA ACA GCA TAG CAG C    
ENT 2A TCC TCC GGC CCC TGA ATG 5' Non-coding 1 120
ENT 2B GAA ACA CGG ACA CCC AAA GTA    
ENT 1C GGC CCC TGA ATG CGG CTA AT   2 90
HRV 1B GGT CCC RTC CCG CAA TT    
FLA 3A (H1)2 GAA ATT TGC TAT GGC TGA C Haemagglutinin 1 482
FLA 3B (H1)2 ATA TTT TGG GCA CTC TCC TAT    
FLA 3C (H1)2 GTC TCT GTA GTG TCT TCA CAT TAT   2 197
FLA 3D (H1)2 CCG GAC CCA AAC CCT CTA CTC    
FLB 1A GTG ACT GGT GTG ATA CCA CT Haemagglutinin 1 900
FLB 1B TGT TTT CAC CCA TAT TGG GC    
FLB 1C CAT TTT GCA AAT CTC AAA GG   2 767
FLB 1D TGG AGG CAA TCT GCT TCA CC    
FLA 2C (H3)2 AGC AAA GCT TTC AGC AAC TG Haemagglutinin 1 591
FLA 2D (H3)2 GCT TCC ATT TGG AGT GAT GC-3    
FLA 2E (H3)2 AGT GCT GAA CGT GAC TAT GC   2 149
FLA 2F (H3)2 TTT GCT GGC TTC TCT TGG T    
RSV 2A GTC TTA CAG CCG TGA TTA GG Nucleoprotein 1 838
RSV 2B GGG CTT TCT TTG GTT ACT TC    
RSVA 2C GAT GTT ACG GTG GGG AGT CT   2 334
RSVA 2D GTA CAC TGT AGT TAA TCA CA    
RSVB 2C AAT GCT AAG ATG GGG AGTTC   2 183
RSVB 2D GAA ATT GAG TTA ATG ACA GC    
ADV 2A2 GCCGCAGTGGTCTTACATGCACATC Hexon 1 301
ADV 2B2 CAGCACGCCGCGGATGTCAAAGT    
ADV 2C32 GACGCCTCGGAGTACCTSWSYCC   2 185
ADV 2DD2 TACGAGTACGTGGTGTCCTCKCGRTC    
  1. 1 HN = Haemagglutinin-neuraminidase gene; 2 Primer sets designed for this study. N.B. 1 = 1st round primer set, 2 = 2nd round primer set; ENT 2A 2B, 1C, HRV 1B primer set = Rhinovirus.