Skip to main content

Table 1 List of primer sequences used for relative quantitative real-time PCR

From: Mycobacterium bovis BCG infection severely delays Trichuris muris expulsion and co-infection suppresses immune responsiveness to both pathogens

Target Forward Reverse
HPRT GACTGTAGATTTTATCAGACT GTCTGGCCTGTATCCAACACTTC
GPDH GGTGGCAGAGGCCTTTG TGCCGATTTAGCATCTCCTT
*18S [30] GTCTGTGATGCCCTTAGATG AGCTTATGACCCGCACTTAC
*TGF-β [30] CCGCAACAACGCCATCTATG CTCTGCACGGGACAGCAAT
*IFN-γ [31] AAGTTCTGGGCTTCTCCTCCTG GCCAGTTCCTCCAGATATCCAAGA
*IL-10 [30] CTGGACAACATACTGCTAACCG GGGCATCACTTCTACCAGGTAA
*IL-4 [31] TCAACCCCCAGCTAGTTGTC TTCAAGCATGGAGTTTTCCC
GATA3 CTGGAGGAGGAACGCTAATG GGTTGAAGGAGCTGCTCTTG
Tbet AGCAAGGACGGCGAATGTT GGGTGGACATATAAGCGGTTC
*Foxp3 [30] CACAATATGCGACCCCCTTTC AACATGCGAGTAAACCAATGGTA
  1. *Primer sequences adapted from reference.