Skip to main content

Table 2 Primers used in this study

From: Arginine deiminase pathway is far more important than urease for acid resistance and intracellular survival in Laribacter hongkongensis: a possible result of arc gene cassette duplication

Primers Sequencea Restriction site
Primers for mutagenesis of ureA   
ureA-UF 5′ GCTCTAGA ATCCTTCATGGGCTGT Xba I
ureA-UR 5′ GCAGGGAGCGGTGGATAACCTCCATTTG  
ureA-DF 5′ TGGAGGTTATCCACCGCTCCCTGCACAC  
ureA-DR 5′ CGCATGC TTCCTCATCAGATGGAGCAGACG Sph I
Inner-ureA-F 5′ TGCATCTCACTCCGCGTGAG  
Inner-ureA-R 5′ TACTGGATCGGGGAATGCAC  
Primers for mutagenesis of ureC   
ureC-UF 5′ TCAGAGCTC CAGGTCGAAGCCGTCTTCAC Sac I
ureC-UR 5′ GTTTCCGGGTTACCCAGACGGATCTTG  
ureC-DF 5′ TCCGTCTGGGTAACCCGGAAACCTTCG  
ureC-DR 5′ TCGTCGAC CGTTGGCCACGAAGATGTCC Sal I
Inner-ureC-F 5′ GTCCGTCCGGAAACCATTGC  
Inner-ureC-R 5′ CCTGCGAGGCAAAGGTGATG  
Primers for mutagenesis of ureD   
ureD-UF 5′ GCGAGCTC CAAGACCGCCATCATCGAAG Sac I
ureD-UR 5′ GGTACATCAGGTCAAACGCGGCGATGGC  
ureD-DF 5′ CGCGTTTGACCTGATGTACCGGGTGGTG  
ureD-DR 5′ GCGTCGAC ACCAGATACAGCCACATCAG Sal I
Inner-ureD-F 5′ TACAGCAGGCGCTGTACTGG  
Inner-ureD-R 5′ GCAGCAGCACGTTGGCAAAG  
Primers for mutagenesis of ureE   
ureE-UF 5′ CGTCTAGA GGAGCCATGTTCCGCGAAT Xba I
ureE-UR 5′ GCATGGTGATGCAGGGCAATCTCCACT  
ureE-DF 5′ AGATTGCCCTGCATCACCATGCGGAAG  
ureE-DR 5′ TGCATGC CATCATCGAGGCCAGTCC Sph I
Inner-ureE-F 5′ TGGCCAGCATCACGCTCAAG  
Inner-ureE-R 5′ TGCAGGTGCTGGTGGGTATG  
Primers for mutagenesis of arcA1   
LPW14961 (arcA1-UF) 5′ CCGCTCGAG TGGATGATCACGGTCAAG Xho I
LPW14962 (arcA1-UR) 5′ GTATTGCGGTCCTGTTCAACCCAGATCAC  
LPW14963 (arcA1-DF) 5′ GGTTGAACAGGACCGCAATACCTATACC  
LPW14964 (arcA1-DR) 5′ CTAGTCTAGA TAGCGGGCCAGCTCTTCG Xba I
LPW16076b (Inner-arcA1-F) 5′ ACATGCTGACCAGGGTTTG  
LPW16077b (Inner-arcA1-R) 5′ AAAGGCTTGTCGTGCCGTTC  
Primers for mutagenesis of arcA2   
LPW14965 (arcA2-UF) 5′ CCGCTCGAG GATTTATTCGCCGGAAAC Xho I
LPW14966 (arcA2-UR) 5′ ACACCGCGATCGTAGTCGTGGTCCTTCTG  
LPW14967 (arcA2-DF) 5′ CACGACTACGATCGCGGTGTTGAAGTG  
LPW14968 (arcA2-DR) 5′ TGCTCTAGA GTACATGCGGCCCAGAAC Xba I
LPW16078c (Inner-arcA2-F) 5′ ATCGCAAGGTGTGCGCCAAC  
LPW16079c (Inner-arcA2-R) 5′ AGCGATTCACGCACCACTTC  
Primers for real-time qPCR   
LPW21629 (arcA1-F) 5′GTCACCCTCAATCCGATG  
LPW21630 (arcA1-R) 5′CACCACACCTTCACCTTG  
LPW21631 (arcA2-F) 5′CCGAAGTGGTGCGTGAATC  
LPW21632 (arcA2-R) 5′TCTTGTTGGTGTAGGTGTTGC  
LPW21635 (rpoB-F) 5′GTGCTGTTCGTCAATGAG  
LPW21636 (rpoB-R) 5′TAGGTCGTAGGATTCTTCG  
LPW22260 (ureA-F) 5′ATCTATTGCCTCGCCGAAGTG  
LPW22261 (ureA-R) 5′AGTGCTGCCGCCGAAATC  
  1. aRestriction sites in the primer sequences are in italic.
  2. bSpecific primers for amplification of arcA1.
  3. cSpecific primers for amplification of arcA2.