Skip to main content

Table 3 The primers used in PCR amplification and sequencing for confirmation of the mutation

From: Comparison of the major virulence-related genes of Listeria monocytogenes in Internalin A truncated strain 36-25-1 and a clinical wild-type strain

Gene Forward Reverse Annealing temperature
dltA AAGTAGTGCAGTTTAGGAGAGGA AGATTGTACCACCGGATGTC 58.0
gtcA TTGAGCTCTTAGTAGAACCTGAC CTGGTTTCGCTATCTCATTAG 54.5
iap CAAAATGCTACTACACACGCT GTCAAAGAATACTAAATCACCAGC 56.5