Skip to main content

Table 1 MAMA real-time PCR assay sequences and targets for genotyping C. gattii

From: Real-time PCR assays for genotyping of Cryptococcus gattii in North America

Genotype Assay Name Gene (SNP position) Base call match/mismatch Universal Primer sequence 5′ -- > 3′ Match MAMA Primer sequence 5′ -- > 3′ Mismatch MAMA Primer sequence 5′ -- > 3′
VGI VGI-MPD471 MPD1 (471) G/A AGACTGTCCCAATGTCAAGCTTTC GCCTTGTATGTGGTAACACCAGTG GWGCCTTGTATGTGGTAACACCAGTA
VGII VGII-MPD495 MPD1 (495) T/A AGACTGTCCCAATGTCAAGCTTTC ATTAACCTTAGTGTTGGAGACCTTGACT AACCTTAGTGTTGGAGACCTTGACA
VGIIa VGIIa-45211 hypothetical protein A/C CCCAGCAACCTTGATCTGGA AGCTGCTCTAAGAGACACATCATCA AGCTGCTCTAAGAGACACATCATCC
VGIIb VGIIb-502129 not annotated G/A AATCGCTCGTCCTCATATGACA GTAGGCGGTGGGATAAGGTG GGTAGGCGGTGGGATAAGGTA
VGIIc VGIIc-257655 non-coding region C/T CGTTAATTTGGTTGTTTGACAACCT AGCAACTCACGCAGAAACAGAC GAGCAACTCACGCAGAAACAGAT
VGIII VGIII-MPD198 MPD1 (198) T/A TGACATTGGGACAGTCTGCAAT ACTGCTGCTTCTCCCGTTGT CTGCTGCTTCTCCCGTTGA
VGIV VGIV-MPD423 MPD1 (423) A/C ACCCAGTCATTAACCTTAGTGTTGGA CTCGTTCGTCAAYCACGTTAGA TCGTTCGTCAAYCACGTTAGC