Skip to main content

Advertisement

Table 1 Primers used in Real Time qPCR

From: Impact of agr dysfunction on virulence profiles and infections associated with a novel methicillin-resistant Staphylococcus aureus (MRSA) variant of the lineage ST1-SCCmec IV

Target gene Primer sequencea Amplicon length (bp) Reference
rnaIII F: AATTTGTTCACTGTGTCGATAAT 135 This study
R:TGGAAAATAGTTGATGAGTTGTT
sarA F: TTCTTTCTCTTTGTTTTCGCTG 115 This study
R: GTTATCAATGGTCACTTATGCT
spa F: TGGTTTGCTGGTTGCTTCTTA 116 This study
R: GCAAAAGCAAACGGCACTAC
hla F: TTTGTCATTTCTTCTTTTTCCCA 169 This study
R: AAGCATCCAAACAACAAACAAAT
psmα F:TATCAAAAGCTTAATCGAACAATTC 176 53
R: CCCCTTCAAATAAGATGTTCATATC
sasG F:GGTTTTCAGGTCCTTTTGGAT 192 This study
R:CTGGTGAAGAGCGAGTGAAA
fnbpA F: ACTTGATTTTGTGTAGCCTTTTT 185 This study
R:GAAGAAGCACCAAAAGCAGTA
fnbpB F:CGTTATTTGTAGTTGTTTGTGTT 118 This study
R:TGGAATGGGACAAGAAAAAGAA
rrna 16S F: AGAGATAGAGCCTTCCCCTT 84 This study
R:TTAACCCAACATCTCACGACA
mecA F:TCCAGATTACAACTTCACCAGG 162 54
  R:CCACTTCATATCTTGTAACG   
  1. aF and R: forward and reverse primers, respectively, in 5´→ 3´orientation. The cycling conditions for all primers were as follows: One cycle of 48°C/30min and 95°C/10 min, followed by 35 cycles of 95°C/30s, 55°C/45s and 72°C/45 s. Each run included a nontemplate and a gene-negative RNA controls.