Probe | Type | Sequence (5´→3´) | No. of Lactobacillus strains detected a | No. of non- Lactobacillus strains detected a | Specificity (%)a | Sensibility (%)a | Reference or source |
---|---|---|---|---|---|---|---|
Lab158b | DNA | GGTATTAGCA(C/T)CTGTTTCCA | 11,991 | 7,165 | 99.30g | 92.69 g | [28] |
LGC354Ac | DNA | TGGAAGATTCCCTACTGC | 12,701 | 12,329 | 98.79 g | 98.18 g | [29] |
LAB759e | DNA | CTACCCATRCTTTCGAGCC | 10,371 | 2,823 | 99.72 g | 80.17 g | [30] |
Name not available | PNA | CCATTGTGGAAGATTC | 12,930 | 14,880 | 98.54 g | 99.95 g | [31] |
Lac663 | PNA | ACATGGAGTTCCACT | 11,837 | 3,548 | 99.65 g | 91.50 g | [26] |
GardV | DNA | CCACCGTTACACCGAGAA | 20 | 39 | 99.99 | 50.00 | [10] |
G.vag1008f | DNA | CTGCAGAGATGTGGTTTCCYTTCG | 39 | 7 | 100.00 | 97.50 | [32] |
G.vag198 | DNA | CCACTAAACACTTTCCCAACAAGA | 34 | 0 | 100.00 | 85.00 | [6] |
GV003 | DNA | AGACGGCTCCATCCCAAAAGGGTT | 32 | 0 | 100.00 | 80.00 | [33] |
Gard162 | PNA | CAGCATTACCACCCG | 38 | 1 | 100.00 | 95.00 | This work |