Skip to main content

Table 2 Theoretical specificity and sensitivity of several primers and probes for Lactobacillus and Gardnerella spp. detection

From: Fluorescence in situ Hybridization method using Peptide Nucleic Acid probes for rapid detection of Lactobacillus and Gardnerella spp.

Probe Type Sequence (5´→3´) No. of Lactobacillus strains detected a No. of non- Lactobacillus strains detected a Specificity (%)a Sensibility (%)a Reference or source
Lab158b DNA GGTATTAGCA(C/T)CTGTTTCCA 11,991 7,165 99.30g 92.69 g [28]
LGC354Ac DNA TGGAAGATTCCCTACTGC 12,701 12,329 98.79 g 98.18 g [29]
LAB759e DNA CTACCCATRCTTTCGAGCC 10,371 2,823 99.72 g 80.17 g [30]
Name not available PNA CCATTGTGGAAGATTC 12,930 14,880 98.54 g 99.95 g [31]
Lac663 PNA ACATGGAGTTCCACT 11,837 3,548 99.65 g 91.50 g [26]
GardV DNA CCACCGTTACACCGAGAA 20 39 99.99 50.00 [10]
G.vag1008f DNA CTGCAGAGATGTGGTTTCCYTTCG 39 7 100.00 97.50 [32]
G.vag198 DNA CCACTAAACACTTTCCCAACAAGA 34 0 100.00 85.00 [6]
Gard162 PNA CAGCATTACCACCCG 38 1 100.00 95.00 This work
  1. a Calculated through ProbeMatch/, last accession, May 2012) with the following data set options: Strain – Both; Source – Both; Size – > 1200 bp; Quality – Both.
  2. b DNA probe that also detects members of Enterococcus, Pediococcus, Weissella, Vagococcus, Leuconostoc and Oenococcus spp. used by Lebeer et al. [34].
  3. c DNA probe mainly detecting members of Lactobacillales and Bacillales, such as Lactobacillus spp., used in Olsen et al. [35].
  4. e DNA probe also detects members of Ruminococcaceae sp. and Pediococcus sp. used in Quevedo et al. [36]; The R symbol of the DNA probe sequence may be Adenosine or Guanosine, therefore Quevedo et al. [36] used a degenerate base in the sequence of the DNA probe to detect Lactobacillus spp.
  5. f The Y symbol of the DNA probe sequence may be Cytidine or Thymidine, therefore Fredricks et al. [6] used a degenerate base in the sequence of the DNA probe to detect G. vaginalis
  6. g Values determined in Machado et al.[26].