Skip to main content

Table 1 Information of loci proposed for MLST of leptospiral isolates

From: Source tracking of human leptospirosis: serotyping and genotyping of Leptospira isolated from rodents in the epidemic area of Guizhou province, China

Gene Size of PCR product (bp) Primer 5’-3’ Annealing temperature (°C)
pntA 638 F: TGCCGATCCTACAACATTA 52
R: AAGAAGCAAGATCCACAACTAC
sucA 560 F: AGAAGAGGCCGGTTATCATCAG 52
R: CTTCCGGGTCGTCTCCATTTA
pfkB 560 F: CCGAAGATAAGGGGCATACC 52
R: CAAGCTAAAACCGTGAGTGATT
tpiA 534 F: AAGCCGTTTTCCTAGCACATTC 52
R: AGGCGCCTACAAAAAGACCAGA
mreA 602 F: AAAGCGGCCAACCTAACACC 52
R: CGATCCCAGACGCAAGTAAG
glmU 557 F: GGAAGGGCACCCGTATGAA 50
R: TCCCTGAGCGTTTTGATTT
fadD 577 F: AGTATGGCGTATCTTCCTCCTT 50
R: TTCCCACTGTAATTTCTCCTAA