Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study

From: Enrichment and characterization of a bacterial culture that can degrade 4-aminopyridine

Primer Sequence (5' to 3') Reference
pA AGAGTTTGATCCTGGCTCAG [7]
(8–28)
pH’ AAGGAGGTGATCCAGCCGCA [7]
(1542–1522)
PRBA338GCf CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG This study
PRBA338f TACGGGAGGCAGCAG [26]
PRUN518r ATTACCGCGGCTGCTGG [26]
PRSTY1 a ACGATAATGACGGTACCCGG This study
PRSTY2 a TTAGCCGGGACTTATTCTCC This study
PRSTZ1 b TACTTACGTGTAAGTAGCTGAAGG This study
PRSTZ2 b CCTTCAGCTACTTACACGTAAGTA This study
PydAf c GAYGAYCAYTTYGARAAYCA This study
PydAr c CATICCRCADATCCAYTC This study
  1. a Used for amplification of the full-length 16S rRNA gene from strain 4AP-Y.
  2. b Used for amplification of the full-length 16S rRNA gene from strain 4AP-Z.
  3. c PydAf and PydAr were designed based on the conserved regions of 3-hydroxy-4-pyridone dioxygenase (3,4-dihydroxypyridine 2,3-dioxygenase), DDHFENH and EWICGM, respectively. R is A or G; Y is C or T; D is A, G, or T; and I is inosine.