Skip to main content

Table 1 Sequences of oligonucleotide primers used in this study

From: Deletion of pic results in decreased virulence for a clinical isolate of Shigella flexneri2a from China

Target gene Gene position on SF301 genome or virulent plasmid pCP301 Primer* Primer sequence (5→3) Length (bp)
Primers for detection of virulence-associated genes of S. flexneri by mPCR
ipaH 1422225–1422835 ** ipaH-F CCTTGACCGCCTTTCCGATA 611
   ipaH-R CAGCCACCCTCTGAGAGTACT  
ial 133550–133869*** ial-F CTGGATGGTATGGTGAGG 320
   ial-R CCAGGCCAACAATTATTTCC  
set1B 3069523–3069669** set1B-F GTGAACCTGCTGCCGATATC 147
   set1B-R ATTTGTGGATAAAAATGACG  
Primers for amplifying int , orf30 , sigA and pic on PAI-1 of S. flexneri 2a
int 3052736–3053998** int-F ATGGCACTGACTGACGCAAA 400
   int-R TGCCGATAAAGGGGAAAACG  
orf30 3096187–3097975** orf30-F CTTATCACTGAGCGTCTGGT 1,102
   orf30-R GTGAAATTCCTGCCTCAATA  
sigA 3060437–3064294** sigA-F AGTCATATTACAGGTGGATTAG 1,866
   sigA-R TATACTCAGGGTTGCGTTTT  
pic 3067737–3070949** pic-F AGAACATATACCGGAAATTC 1,219
   pic-R ACCCTGACGGTGAATAAACT  
Primers for homologous recombination to construct pic knockout strain
upstream of pic 3067236–3067745** uppic-F-NotI AAGCGGCCGCCATAGCAGACTGGCCGGTCAACC 520
   uppic-R-XbaI CCTCTAGAATGTTCTGATGTGGGGGTAAAGGGC  
downstream of pic 3071850–3072358 ** downpic-F-XbaI CCTCTAGAATTCACTATGGATTCTCCATGAT 517
   downpic-R-BamHI AAGGATCCCGTCGTCCGTCTGGCACC  
upstreamof pic 3066436–3072733** Upuppic-F GCTGAACTGC TGGAGCCGCT 1176
downstream of pic   Downdown Pic-R CAGCGGCGAAATACTGTACC  
pic coding frame work 3067737–3070949** pic-pSC-F-PfMlI AAACCATCGAATGGATGCAGGACGATTTCGATGCCCCCGTAGAC 3,213
   pic-pSC-R-AclI TTTAACGTTTCAGAACATATACCGGAAATTCGCGTT  
  1. *F, forward primer; R, reverse primer.
  2. **SF301 GenBank Accession No. AE005674.
  3. ***SF301 large virulent plasmid pCP301 GenBank Accession No. AF386526.
  4. Underlined sequences represent restriction endonuclease sites.