Skip to main content

Advertisement

Table 2 Description of primers used in PCR for the detection of virulence markers and erythromycin/clindamycin-resistance genes

From: Commensal Streptococcus agalactiaeisolated from patients seen at University Hospital of Londrina, Paraná, Brazil: capsular types, genotyping, antimicrobial susceptibility and virulence determinants

Target genea Sequence of the primer (5′ → 3′) Amplicon size (bp) Accession numberb
hylB F: TGTCTCCGAGGTGACACTTGAACT 124 U15050.1/Y15903.1
R: TTGTGTTGTGACGGGTTGTGGATG
cylE F: TCGGAACAAGTAAAGAGGGTTCGG 130 AF093787.2/AF157015.2
R: GGGTTTCCACAGTTGCTTGAATGT
PI-1 F: AACCACTAGCAGGCGTTGTCTTTG 147 EU929540.1/EU929469.1
R: TGAGCCCGGAAATTCTGATATGCC
PI-2a F: GCCGTTAGATGTTGTCTTCGTACT 117 EU929374.1/EU929330.1
R: TTTACTGCGGTCCCAAGAGCTTC
PI-2b F: AAGTCTTGACCAAGGATACGACGC 152 EU929426.1/EU929391.1
R: ATCGTGTTACTTGCCCTGCGTA
ermA F: CCGGCAAGGAGAAGGTTATAATGA 190 EU492925.1/EU492926.1
R: GCATTCACCCGTTGACTCATTTCC
ermB F: GCTCTTGCACACTCAAGTCTCGAT 117 EF422365.1/DQ250996.1
R: ACATCTGTGGTATGGCGGGTAAGT
mefA/E F: GCGATGGTCTTGTCTATGGCTTCA 225 DQ445273.1/DQ445269.1
  R: AGCTGTTCCAATGCTACGGAT   
  1. ahylB, hyaluronate lyase; cylE, hemolysin/cytolysin (β-H/C); PI-1, PI-2a, PI-2b, pilus islands; ermA, ermB cross-resistance to macrolides-lincosamide-streptogramin B; mefA/E resistance only to 14- and 15-membered ring macrolides. bThe nucleotide sequences of Streptococcus agalactiae genes deposited in the GenBank/EMBL databases used for specific primer design.