Skip to main content

Advertisement

Table 1 Primers sequences used in this study

From: Molecular analysis and distribution of multidrug-resistant Enterococcus faeciumisolates belonging to clonal complex 17 in a tertiary care center in Mexico City

Gene Primer Sequence (5′ to 3′) Size (bp) Reference
vanA vanA-F CATGAATAGAATAAAAGTTGCAATA 1,030 (Clark et al., 1993) [23]
vanA-R CCCCTTTAACGCTAATACGATCAA
vanB vanB-F GTCACAAACCGGAGGCGAGGA 433 (Clark et al., 1993) [23]
vanB-R CCGCCATCCTCCTGCAAAAAA
esp Efm esp-F TTGCTAATGCTAGTCCACGACC 945 (Shankar et al., 1999) [25]
esp-R GCGTCAACACTTGCATTGCCGA
hyl Efm hyl-F GAGTAGAGGAATATCTTAGC 661 (Rice et al., 2003) [14]
hyl-R AGGCTCCAATTCTGT