Primers | Sequence (5' to 3', italicized sequences are designed restriction sites) | Purpose and description | Reference |
---|---|---|---|
Pm262 | ATCGAGGATCCATGAAACTAATGACGTTATTG | For whole Plp protein, forward | This study |
Pm263 | ATCGAAGATC TTTGAAATTGAAATGACGCGAG | For whole Plp protein, reverse | This study |
Pm212 | GACACCTCACAATATGAAATAAAA | For truncated Plp protein, forward | This study |
Pm213 | TTTGAGCTGCGGGGCTTTGGTTGC | For truncated Plp protein, reverse | This study |
Pm261 | ATCGAGAGCTCGCAGAATCGTGACTGACGCCG | For insertional plp mutation, forward, with SacI site | This study |
SD Lip/Heme R1 | GCTAGTCTAGAACGGATACCACCTCAGA | For insertional plp mutation, reverse, with XbaI site | [8] |
pr1 | GGGGAATTCTTATTCAAATTGAAATGACGCGAG | For plp complement, forward, with EcoRI site | This study |
pr2 | GGGACCGGTGAATACCCATTTTTTATTTTTTC | For plp complement, reverse, with AgeI site | This study |
pr3 | GTTGAATTCGTATTTTCTGCAATCGCCATG | For vah1 complement, forward, with EcoRI site | This study |
pr4 | GGGACCGGTCTATTTTATAATAAATTGAATACCAT | For vah1 complement, reverse, with AgeI site | This study |
Pm256 | ATCGACTCGAGCTGGAGAAGATGTACTCTGCG | For allelic exchange rtxA mutation, flanking the 5' region, forward, with XhoI site | This study |
Pm257 | ATCGATCTAGACGTATCATCTACAGCTTTTGC | For allelic exchange rtxA mutation, flanking the 5' region, reverse, with XbaI site | This study |
Pm258 | ATCGATCTAGATTATATTAATCATGTCTTTTATGGG | For allelic exchange rtxA mutation, flanking the 3' region, forward, with XbaI site | This study |
Pm259 | ATCGAGAGCTCCTGATTGCCTAGCAGTAGCCC | For allelic exchange rtxA mutation, flanking the 3' region, reverse, with SacI site | This study |
pr7 | CAGGAAACAGCTATGACCATGATTACG | For sequencing of the DNA fragment inserted in pCR2.1 TA-ligation site | This study |
pr8 | CTACGGGCTTGAGCGTGACAATC | For sequencing of the DNA fragment inserted in pSUP202 AgeI site | This study |
pr25ex | GCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCG | For sequencing of the DNA fragment inserted in pNQ705-1 Multi-cloning site | This study |