Skip to main content

Table 3 Primers used in this study

From: Characterization of Plp, a phosphatidylcholine-specific phospholipase and hemolysin of Vibrio anguillarum

Primers Sequence (5' to 3', italicized sequences are designed restriction sites) Purpose and description Reference
Pm262 ATCGAGGATCCATGAAACTAATGACGTTATTG For whole Plp protein, forward This study
Pm263 ATCGAAGATC TTTGAAATTGAAATGACGCGAG For whole Plp protein, reverse This study
Pm212 GACACCTCACAATATGAAATAAAA For truncated Plp protein, forward This study
Pm213 TTTGAGCTGCGGGGCTTTGGTTGC For truncated Plp protein, reverse This study
Pm261 ATCGAGAGCTCGCAGAATCGTGACTGACGCCG For insertional plp mutation, forward, with SacI site This study
SD Lip/Heme R1 GCTAGTCTAGAACGGATACCACCTCAGA For insertional plp mutation, reverse, with XbaI site [8]
pr1 GGGGAATTCTTATTCAAATTGAAATGACGCGAG For plp complement, forward, with EcoRI site This study
pr2 GGGACCGGTGAATACCCATTTTTTATTTTTTC For plp complement, reverse, with AgeI site This study
pr3 GTTGAATTCGTATTTTCTGCAATCGCCATG For vah1 complement, forward, with EcoRI site This study
pr4 GGGACCGGTCTATTTTATAATAAATTGAATACCAT For vah1 complement, reverse, with AgeI site This study
Pm256 ATCGACTCGAGCTGGAGAAGATGTACTCTGCG For allelic exchange rtxA mutation, flanking the 5' region, forward, with XhoI site This study
Pm257 ATCGATCTAGACGTATCATCTACAGCTTTTGC For allelic exchange rtxA mutation, flanking the 5' region, reverse, with XbaI site This study
Pm258 ATCGATCTAGATTATATTAATCATGTCTTTTATGGG For allelic exchange rtxA mutation, flanking the 3' region, forward, with XbaI site This study
Pm259 ATCGAGAGCTCCTGATTGCCTAGCAGTAGCCC For allelic exchange rtxA mutation, flanking the 3' region, reverse, with SacI site This study
pr7 CAGGAAACAGCTATGACCATGATTACG For sequencing of the DNA fragment inserted in pCR2.1 TA-ligation site This study
pr8 CTACGGGCTTGAGCGTGACAATC For sequencing of the DNA fragment inserted in pSUP202 AgeI site This study
pr25ex GCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCG For sequencing of the DNA fragment inserted in pNQ705-1 Multi-cloning site This study