Skip to main content

Advertisement

Table 6 Primer sequences used for the qRT-PCR

From: C. albicansgrowth, transition, biofilm formation, and gene expression modulation by antimicrobial decapeptide KSL-W

Gene Primer sequence 5′ to 3′ Amp size (bp)
ACT1 Forward : GCTGGTAGAGACTTGACCAACCA 87
Reverse : GACAATTTCTCTTTCAGCACTAGTAGTGA
SAP2 Forward : TCCTGATGTTAATGTTGATTGTCAAG 82
Reverse : TGGATCATATGTCCCCTTTTGTT
SAP4 Forward : AGATATTGAGCCCACAGAAATTCC 82
Reverse : CAATTTAACTGCAACAGGTCCTCTT
SAP5 Forward : CAGAATTTCCCGTCGATGAGA 78
Reverse : CATTGTGCAAAGTAACTGCAACAG
SAP6 Forward : TTACGCAAAAGGTAACTTGTATCAAGA 102
Reverse : CCTTTATGAGCACTAGTAGACCAAACG
ALS3 Forward : AATGGTCCTTATGAATCACCATCTACTA 51
Reverse : GAGTTTTCATCCATACTTGATTTCACAT
HWP1 Forward : GCTCAACTTATTGCTATCGCTTATTACA 67
Reverse : GACCGTCTACCTGTGGGACAGT
EAP1 Forward : CTGCTCACTCAACTTCAATTGTCG 51
Reverse : GAACACATCCACCTTCGGGA
EFG1 Forward : TATGCCCCAGCAAACAACTG 202
Reverse : TTGTTGTCCTGCTGTCTGTC
NRG1 Forward : CACCTCACTTGCAACCCC 198
Reverse : GCCCTGGAGATGGTCTGA