Skip to main content

Advertisement

Table 3 Primers used in this study

From: Effect of a ctrA promoter mutation, causing a reduction in CtrA abundance, on the cell cycle and development of Caulobacter crescentus

5podJ2508 GCCTGGTGGGCCGCTCTGAT
3podJ4522 CGGTTGGGGACATCGTCCCC
pleCfor ATCGTCGTCGACTTGCCCGCGCCC
pleCrev GCCAGCAAGGCGCTCGGCTGACGA
pBGST181 ATGGCAAGATCCTGGTAT
pBGST182 CGATAATGTCGGGCAATC
MarRseq CGGGTATCGCTCTTGAAGGGA
M134UP GGACGAGTCGGAATTCCAGACCG
M134DN GCCTTCAGACTCTAGAATGAGTTCG
CtrAlacUp CAGAACGCCGGAATTCCGTCCGTGA