Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons

Mujahid, Sana; Orsi, Renato H; Boor, Kathryn J; Wiedmann, Martin

doi:10.1186/1471-2180-13-156

BMC Microbiology

Table 2 Proteins found to be differentially regulated by σ^L, as determined by a proteomic comparison between L. monocytogenes 10403S Δ BCH and Δ BCHL

From: Protein level identification of the Listeria monocytogenes Sigma H, Sigma L, and Sigma C regulons

Protein^a	Fold change Δ BCH/ΔBCHL	Description	Gene name	Role category^b	Sub-Role category^b
Proteins with positive fold change ( > 1.5) and p < 0.05 (indicating positive regulation by σ^L)
Lmo0096^d,f	64.16	mannose-specific PTS system IIAB component ManL	mptA	Energy metabolism	Pyruvate dehydrogenase
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo2006^g	3.41	acetolactate synthase catabolic	alsS	Amino acid biosynthesis	Aspartate family
				Amino acid biosynthesis	Pyruvate family
Proteins with negative fold change ( < -1.5) and p < 0.05 (indicating negative regulation by σ^L)
Lmo0027^c,e	−3.62	beta-glucoside-specific PTS system IIABC component	lmo0027	Transport and binding proteins	Carbohydrates, organic alcohols, and acids
				Amino acid biosynthesis	Aromatic amino acid family
				Energy metabolism	Pyruvate dehydrogenase
Lmo0130	−3.64	hypothetical protein	lmo0130	Unclassified	Role category not yet assigned
Lmo0178	−2.07	hypothetical protein	lmo0178	Regulatory functions	Other
Lmo0181	−3.25	multiple sugar transport system substrate-binding protein	lmo0181	Transport and binding proteins	Unknown substrate
Lmo0260	−1.68	hydrolase	lmo0260	Hypothetical proteins	Conserved
Lmo0278	−1.67	maltose/maltodextrin transport system ATP-binding protein	lmo0278	Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo0319^c,e	−2.96	beta-glucosidase	bglA	Energy metabolism	Sugars
Lmo0343	−3.94	transaldolase	tal2	Energy metabolism	Pentose phosphate pathway
Lmo0344	−4.69	short chain dehydrogenase	lmo0344	Energy metabolism	Biosynthesis and degradation of polysaccharides
Lmo0345	−6.04	ribose 5-phosphate isomerase B	lmo0345	Energy metabolism	Pentose phosphate pathway
Lmo0346	−2.74	triosephosphate isomerase	tpiA2	Energy metabolism	Glycolysis/gluconeogenesis
Lmo0348	−2.41	dihydroxyacetone kinase	lmo0348	Fatty acid and phospholipid metabolism	Biosynthesis
				Energy metabolism	Sugars
Lmo0391	−1.67	hypothetical protein	lmo0391
Lmo0401	−2.16	alpha-mannosidase	lmo0401	Unclassified	Role category not yet assigned
Lmo0517^e	−3.21	phosphoglycerate mutase	lmo0517	Energy metabolism	Glycolysis/gluconeogenesis
Lmo0521	−2.23	6-phospho-beta-glucosidase	lmo0521	Energy metabolism	Sugars
Lmo0536	−1.97	6-phospho-beta-glucosidase	lmo0536	Central intermediary metabolism	Other
Lmo0574	−1.65	6-phospho-beta-glucosidase GmuD	lmo0574	Central intermediary metabolism	Other
Lmo0640	−1.78	oxidoreductase	lmo0640	Energy metabolism	Fermentation
				Central intermediary metabolism	Other
				Energy metabolism	Electron transport
Lmo0643	−2.61	transaldolase	lmo0643	Energy metabolism	Pentose phosphate pathway
Lmo0689	−1.71	chemotaxis protein CheV	lmo0689	Cellular processes	Chemotaxis and motility
Lmo0690	−2.44	flagellin	flaA	Cellular processes	Chemotaxis and motility
Lmo0692	−1.66	chemotaxis protein CheA	cheA	Cellular processes	Chemotaxis and motility
Lmo0813	−2.04	fructokinase	lmo0813	Energy metabolism	Sugars
Lmo0930	−1.88	hypothetical protein	lmo0930	Unclassified	Role category not yet assigned
Lmo1242	−1.59	hypothetical protein	lmo1242	Hypothetical proteins	Conserved
Lmo1254	−2.10	alpha-phosphotrehalase	lmo1254	Energy metabolism	Biosynthesis and degradation of polysaccharides
Lmo1348	−2.42	glycine cleavage system T protein	gcvT	Energy metabolism	Amino acids and amines
Lmo1349	−2.68	glycine cleavage system P-protein	gcvPA	Energy metabolism	Amino acids and amines
				Central intermediary metabolism	Other
Lmo1350^e	−2.11	glycine dehydrogenase subunit 2	gcvPB	Central intermediary metabolism	Other
				Energy metabolism	Amino acids and amines
Lmo1388^e	−2.02	ABC transport system	tcsA	Unclassified	Role category not yet assigned
Lmo1389	−2.32	simple sugar transport system ATP-binding protein	lmo1389	Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo1538^e	−1.89	glycerol kinase	glpK	Energy metabolism	Other
Lmo1699	−1.92	Methyl-accepting chemotaxis protein	lmo1699	Cellular processes	Chemotaxis and motility
Lmo1730	−2.55	lactose/L-arabinose transport system substrate-binding protein	lmo1730	Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo1791	−1.75	hypothetical protein	lmo1791
Lmo1812	−1.70	L-serine dehydratase iron-sulfur-dependent alpha subunit	lmo1812	Energy metabolism	Amino acids and amines
				Energy metabolism	Glycolysis/gluconeogenesis
Lmo1856	−1.65	purine nucleoside phosphorylase	deoD	Purines, pyrimidines, nucleosides, and nucleotides	Salvage of nucleosides and nucleotides
Lmo1860	−1.64	peptide-methionine (S)-S-oxide reductase	msrA	Protein fate	Protein modification and repair
Lmo1877	−2.14	formate-tetrahydrofolate ligase	fhs	Amino acid biosynthesis	Aspartate family
				Protein synthesis	tRNA aminoacylation
				Amino acid biosynthesis	Histidine family
				Purines, pyrimidines, nucleosides, and nucleotides	Purine ribonucleotide biosynthesis
				Biosynthesis of cofactors, prosthetic groups, and carriers	Pantothenate and coenzyme A
Lmo1954^e	−1.97	phosphopentomutase	deoB	Purines, pyrimidines, nucleosides, and nucleotides	Salvage of nucleosides and nucleotides
Lmo1993	−1.81	pyrimidine-nucleoside phosphorylase	pdp	Purines, pyrimidines, nucleosides, and nucleotides	Salvage of nucleosides and nucleotides
Lmo2094	−28.99	hypothetical protein	lmo2094	Energy metabolism	Sugars
Lmo2097	−12.12	galactitol-specific PTS system IIB component	lmo2097	Energy metabolism	Pyruvate dehydrogenase
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo2098	−3.96	galactitol-specific PTS system IIA component	lmo2098	Energy metabolism	Pyruvate dehydrogenase
				Amino acid biosynthesis	Aromatic amino acid family
				Transport and binding proteins	Carbohydrates, organic alcohols, and acids
Lmo2160	−2.37	sugar phosphate isomerase/epimerase	lmo2160	Hypothetical proteins	Conserved
Lmo2161	−2.58	hypothetical protein	lmo2161	Hypothetical proteins	Conserved
Lmo2362	−1.87	glutamate/gamma-aminobutyrate antiporter	lmo2362	Transport and binding proteins	Amino acids, peptides and amines
Lmo2425	−1.59	glycine cleavage system H protein	gcvH	Energy metabolism	Amino acids and amines
Lmo2481	−1.52	pyrophosphatase PpaX	ppaX	Central intermediary metabolism	Other
Lmo2529	−1.72	ATP synthase F1 beta subunit	atpD2	Energy metabolism	ATP-proton motive force interconversion
Lmo2648	−2.50	hypothetical protein	lmo2648	Unclassified	Role category not yet assigned
Lmo2664	−1.72	L-iditol 2-dehydrogenase	lmo2664	Central intermediary metabolism	Other
				Energy metabolism	Glycolysis/gluconeogenesis
				Energy metabolism	Electron transport
				Energy metabolism	TCA cycle
				Energy metabolism	Fermentation
Lmo2696	−2.68	dihydroxyacetone kinase L subunit	lmo2696	Energy metabolism	Sugars
				Fatty acid and phospholipid metabolism	Biosynthesis
Lmo2697	−3.10	dihydroxyacetone kinase	lmo2697	Hypothetical proteins	Conserved
Lmo2743	−2.71	transaldolase	tal1	Energy metabolism	Pentose phosphate pathway

^aProtein names are based on the L. monocytogenes EGD-e locus.
^bRole Categories and Sub-Role categories are based on JCVI classification [26].
^cReported as negatively regulated by σ^L in Chaturongakul et al., 2011 [7].
^dReported as downregulated in a rpoN (σ^L) mutant compared to wildtype L. monocytogenes EGD-e in Arous et al., 2004 [22].
^eReported as upregulated in a rpoN (σ^L) mutant compared to wildtype L. monocytogenes EGD-e in Arous et al., 2004 [22].
^fPreceded by a putative σ^L promoter; tggca cagaacttgca; -12 and -24 regions are underlined.
^gPreceded by a putative σ^A promoter; ttgcaa taattcttttgagtagtataat; -10 and -35 regions are underlined.

Back to article page

ISSN: 1471-2180

Contact us

General enquiries: journalsubmissions@springernature.com