Skip to main content

Table 4 Primers for construction of the arp mutagenic cassette and verification of allelic exchange

From: Influence of arthritis-related protein (BBF01) on infectivity of Borrelia burgdorferi B31

Primer Sequence (5′ > 3′) Application
ARP01 GCCTTTCGTTAAGGTTTTGTTT amplify arp upstream homology
ARP02 GGAAATCTTCCTTGAAGCTCGGGTACAA SOEing arp upstream homology
  GTTGTTCCTCCTAAATTAAATAAAAATAA to aadA cassette
ARP03 TACCCGAGCTTCAAGGAAG amplify aadA cassette
ARP04 GGTATATGTAATTTCGACTTTAAGTTAAAAAT SOEing arp downstream
  CCGATTGTTTCATTTGCCGACTACCTTGGT homology to aadA cassett
ARP05 GAACAATCGGATTTTTTAACTTAAAGTCG amplify arp dowsteam homology
ARP06 ACCCCAGTAACTCAATTTCTAATTG amplify arp dowsteam homology
ARP07 TTTCTTGATTAGGGTAAAAAATTCT check integration at 5′ end
ARP08 GTCTTGTATTGTTGAACAAAACACTT check integration at 3′ end
ARP09 GTTTCCATATGAGGGAAGCG check integration within aadA
ARP10 CCAAGCGATCTTCTTCTTGTC check integration within aadA
\