Skip to main content

Table 1 Sequence of primers used to amplify amastin isoforms ORFs.

From: Distinct genomic organization, mRNA expression and cellular localization of members of two amastin sub-families present in Trypanosoma cruzi

Primer name / gene ID Primer Sequence (5’-3’) Restriction enzyme
pδ1-amastin (F) Tc00.1047053511071.40 TTGTTCTAGAGTAGGAAGCAATG XbaI
pδ1-amastin (R) Tc00.1047053511071.40 CGCTGGATCCGAACCACGTGCA BamHI
β1-amastin (F) Tc00.1047053509965.390 CCTAGGAGGATGTCGAAGAAGAAG AvrII
β1-amastin (R) Tc00.1047053509965.390 AGATCTCGAGCACAATGAGGCCCAG BglII
β2-amastin (F) Tc00.1047053509965.394 TCTAGATGGGCTTCGAAACGCTTGC XbaI
β2-amastin (R) Tc00.1047053509965.394 GGATCCCCAGTGCCAGCAAGAAGACTG BamHI
  1. The underlined sequences correspond to the restriction sites recognized by the restriction enzyme.