Skip to main content

Table 2 Primers and amplification conditions

From: Multilocus genetics to reconstruct aeromonad evolution

Locus Function Putative gene product Gene sizea(bp) Locus positiona(bp) Primerb Primer sequence 5’-3’ Sequence length amplified (alignment length) (bp) Amplification conditions
dnaK Stress response Heat shock 70 kDa protein (HSP 70) 1,928 3357741 DnaK-F
DnaK-R
ATGAAGAAGACCGCCGAAG
TGCAGCACGTGAATGGTC
816
(816)
45s at 94°C;
45s at 63°C;
45s at 72°C
gltA Glycolytic pathway Type II citrate synthase 1,286 2098162 GltA-F
GltA-R
TTCCGTCTGCTCTCCAAGAT
GCAGCGGATCCTTGATCT
462
(462)
45s at 94°C;
45s at 63°C;
45s at 72°C
gyrB Replication Subunit DNA gyrase 2,411 3883 GyrB3F
GyrB14R
(Yáñez, 2003) 783-786
(792)
45s at 94°C;
45s at 65°C;
45s at 72°C
radA DNA repair DNA repair protein, RadA 1,364 4108941 RadA-F
RadA-R
ATGCATCACCTGGATGGAGT
TGCCTATGTTTGTACCGAATG
405-414
(420)
45s at 94°C;
45s at 60°C;
45s at 72°C
rpoB Transcription DNA-directed RNA polymerase β subunit 4,091 4466890 Pasrpob-L
Rpob-R
(Korczak, 2004) 426
(426)
45s at 94°C;
45s at 65°C;
45s at 72°C
tsf Protein translation Elongation factor Ts 881 1272267 Tsf-F
Tsf-R
CGCTGGCATGATGGATTG
GATGCCTTCGCCCACTTC
702
(702)
45s at 94°C;
45s at 65°C;
45s at 72°C
zipA Cell division Cell division protein ZipA 1,112 1337458 ZipA-F
ZipA-R
TTGCGTTACATCTTGGTTGC
ATCCGGTACGGATTGAAGGT
429-507
(537)
1min at 94°C;
45s at 55°Cc;
1min at 72°C
  1. aGene start codon position on the circular chromosome sequence of A. hydrophila subsp. hydrophila ATCC 7966T (accession number NC_008570).
  2. bF, forward primer; R, reverse primer.
  3. cSome strains belonging to A. caviae and A. media clades were amplified using a 4 mM MgCl2 concentration and a primer hybridization temperature of 50°C (A. caviae).