Table 2 Primers and amplification conditions
From: Multilocus genetics to reconstruct aeromonad evolution
Locus | Function | Putative gene product | Gene sizea(bp) | Locus positiona(bp) | Primerb | Primer sequence 5’-3’ | Sequence length amplified (alignment length) (bp) | Amplification conditions |
|---|---|---|---|---|---|---|---|---|
dnaK | Stress response | Heat shock 70 kDa protein (HSP 70) | 1,928 | 3357741 | DnaK-F DnaK-R | ATGAAGAAGACCGCCGAAG TGCAGCACGTGAATGGTC | 816 (816) | 45s at 94°C; 45s at 63°C; 45s at 72°C |
gltA | Glycolytic pathway | Type II citrate synthase | 1,286 | 2098162 | GltA-F GltA-R | TTCCGTCTGCTCTCCAAGAT GCAGCGGATCCTTGATCT | 462 (462) | 45s at 94°C; 45s at 63°C; 45s at 72°C |
gyrB | Replication | Subunit DNA gyrase | 2,411 | 3883 | GyrB3F GyrB14R | (Yáñez, 2003) | 783-786 (792) | 45s at 94°C; 45s at 65°C; 45s at 72°C |
radA | DNA repair | DNA repair protein, RadA | 1,364 | 4108941 | RadA-F RadA-R | ATGCATCACCTGGATGGAGT TGCCTATGTTTGTACCGAATG | 405-414 (420) | 45s at 94°C; 45s at 60°C; 45s at 72°C |
rpoB | Transcription | DNA-directed RNA polymerase β subunit | 4,091 | 4466890 | Pasrpob-L Rpob-R | (Korczak, 2004) | 426 (426) | 45s at 94°C; 45s at 65°C; 45s at 72°C |
tsf | Protein translation | Elongation factor Ts | 881 | 1272267 | Tsf-F Tsf-R | CGCTGGCATGATGGATTG GATGCCTTCGCCCACTTC | 702 (702) | 45s at 94°C; 45s at 65°C; 45s at 72°C |
zipA | Cell division | Cell division protein ZipA | 1,112 | 1337458 | ZipA-F ZipA-R | TTGCGTTACATCTTGGTTGC ATCCGGTACGGATTGAAGGT | 429-507 (537) | 1min at 94°C; 45s at 55°Cc; 1min at 72°C |