Skip to main content

Advertisement

Table 1 Gene locus, given names, features, gene conservation, sequence of the primers employed for DNA amplification, and molecular mass of expressed recombinant proteins

From: “Features of two proteins of Leptospira interrogans with potential role in host-pathogen interactions”

Gene locus1 Given name2 Description/ Function Conservation (identity)3 Sequence of primers for PCR amplification Molecular mass
LIC11834 Lsa33 Putative lipoprotein Lai (99%) LBH (87%) LBP (31%) F:5′CTCGAG GATCTACAAGGTGGGGTTTTTAC3′ XhoI R:5′CCATGG TTACTGAGGTTTTACTTGGTCC3′ NcoI 33.1 kDa
LIC12253 Lsa25 Conserved hypothetical protein Lai (100%) LBH (77%) LBP (39%) F:5′ CTCGAG GAGGAGAAACCGGACGATAC 3′ XhoI R:5′CCATGG TTAGGGAAGACTTCTAACACATC3′ NcoI 24.07 kDa
  1. 1http://aeg.lbi.ic.unicamp.br/world/lic/; LIC: Leptospira interrogans Copenhageni
  2. 2Lsa: Leptospiral surface adhesin of 33 and 24 kDa; we have named the latter as Lsa25 because Lsa24 has been already described (Barbosa et al., 2006)
  3. 3 http://blast.ncbi.nlm.nih.gov/Blast.cgi/