Skip to main content

Table 1 Characteristics of seven microsatellite markers developed from 'Candidatus Liberibacter asiaticus'

From: Multilocus microsatellite analysis of 'Candidatus Liberibacter asiaticus' associated with citrus Huanglongbing worldwide

SSR Markers Primer sequences (5'-----3') Repeats Location in genome ORF Ta (°C) Size range (bp) No. of alleles H
LasSSR-A-f
LasSSR-A-r
FAM-CGCCTACAGGAATTTCGTTACG
TCTCATCTTGTTGCTTCGTTTATCC
(TATTCTG)8 255477-255753 adenosine deaminases 50°C 241-434 30 0.881
LasSSR-B-f
LasSSR-B-r
VIC-ATCGCCTATAAATCCCTTTACTGATATGTTTCC
TGGTAACGGAAGTGATAATAACTACAGCAATAAG
(TTTAA)6 669257-669458 hypothetical protein 60°C 196-206 3 0.216
LasSSR-C-f
LasSSR-C-r
VIC-CGATTGTTGATGAATTACC
GAATAGAAGAACCCTAAGC
(CAGT)8 666722-666947 phosphohydrolases 50°C 208-254 15 0.613
LasSSR-D-f
LasSSR-D-r
NED-CGGTGTCGGTATCGGTATCATTC
CGAAGAAGAGACGGAGGTTAAGC
(TTC)5 377678-377850 hypothetical protein 55°C 158-174 3 0.391
LasSSR-E-f
LasSSR-E-r
NED-GATCAGTAGTCTATCACCAC
TACTGGAAACAAATGGAATAC
(CTTGTGT)5 354424-354613 transcriptional regulator 50°C 173-290 17 0.587
LasSSR-F-f
LasSSR-F-r
FAM-TCGTCTTATCGTATATCACTCC
TTCACTATTAAAGGATCAAGGC
(TTTACATC)3 520542-520307 repair ATPase 52°C 227-235 2 0.204
LasSSR-G-f
LasSSR-G-r
FAM-CGGGAGAAATTAAAGATGATGG
CGCTGTTAATACATACTTACGC
(TTGTTGGA)2 998251-998403 hypothetical protein 53°C 139-152 2 0.204
  1. Ta, annealing temperature of the primer pairs; H, Haploid genetic diversity
  2. Each forward primer was labeled with FAM, NED, VIC fluorescent dyes at 5', respectively