Skip to main content

Table 1 Oligonucleotide primers pairs used in this study

From: Characteristics of a broad lytic spectrum endolysin from phage BtCS33 of Bacillus thuringiensis

Primer pairs Sequence (5'-3') PCR products (Size) Predicted products/Size (amino acid residues)
plyBt33-F/ BamHI GAGGATCC*ATGGGTTACACTGTAGATATTTC plyBt33 (816bp) PlyBt33/33kDa (amino acid residues 1–272)
plyBt33-F/ BamHI GAGGATCCATGGGTTACACTGTAGATATTTC plyBt33-N (558bp) PlyBt33-N/24kDa (amino acid residues 1–186)
plyBt33-IC-F/BamHI GAGGATCCCTTGGATACACTTCAAAAAT plyBt33-IC (258bp) PlyBt33-IC/11kDa (amino acid residues 187–272)
  1. *The characters underline represents the restriction enzymes digest sites.