Skip to main content

Table 1 Primers used in this study

From: Quorum-sensing regulates biofilm formation in Vibrio scophthalmi

  Sequence (5’-3’) Target gene Reference
LuxR-A GGACTAGTTACTAATTAGGGCAA luxR null mutant This study
LuxRI-F4 AAGTGTGGTTTGAGTGGA Detection of luxR and
LuxRI-R4 TAAGCAACAGCTGATGGA flanking regions
LuxS-R7 GAGTGCATCGCTGCAGTAC flanking regions
  1. Restriction sites for SpeI (ACTAGT), BamHI (GGATCC), EcoRI (GAATTC), SalI (GTCGAC) and SacI (GAGCT) are indicated in bold.