Skip to main content

Table 1 Primers designed and used in this work

From: Enhancement of carotenoid production by disrupting the C22-sterol desaturase gene (CYP61) in Xanthophyllomyces dendrorhous

Primer Sequence 5’ to 3’ Target
1 H-out.F CTCGATGAGCTGATGCTTTG Hygromycin B resistance cassette
2 H-out.R TCCATCACAGTTTGCCAGTG Hygromycin B resistance cassette
3 Zeo.F TGAACAGGGTCACGTCGT Zeocin resistance cassette
4 Zeo.R CGCTGATGAACAGGGTCAC Zeocin resistance cassette
5 CYP61up2.F CTGGAGCCGAATTCATTGAT CYP61 gene
6 CYP61dw2.R AGGAGGCAGAGTGGTTGAGA CYP61 gene
7 CYP61b.F GTCGGAGGAAGAGCAGTTTG CYP61 gene
8 CYP61.F CTGAGCCCTGTCTTGTTGCC CYP61 gene
9 CYP61.R ATTGTACACCTTTGTTCCAGGC CYP61 gene
RT-qPCR (The pairs of primers used had efficiency greater than 95%, as determined by standard curves with a correlation coefficient of R2 ≥ 0.996):
10 mactF-RT CCGCCCTCGTGATTGATAAC ACT gene
11 mactR-RT TCACCAACGTAGGAGTCCTT ACT gene
12 hmgR.F-RT GGCCGATCGCTATACATCCGTTT HMGR gene
13 hmgR.R-RT ATCCAGTTGATGGCAGAAGGCT HMGR gene
  1. F and R in the primer name indicate the primer orientation.