Skip to main content

Table 1 Oligonucleotide primers used in this study

From: SspA up-regulates gene expression of the LEE pathogenicity island by decreasing H-NS levels in enterohemorrhagic Escherichia coli

Application Name Oligonucleotide sequence (5’ to 3’)
Strain construction PKD13sspAUS2 ACTATCATCCAATTTTCTGCCCAAATGTCGGGTATTGCTCAGGAGGTTTCTTTCATGATGTCCGGGGATCCGTCGACCTGC
  PKD13sspADS AGATTAACTCCGGCCCAGACGCATTTCACGTTCTGCTTCAGTGTAGGCTGGAGCTGCTTCGA
  sspABUS GATTGGATCCGGCTTCGTTACTCGTGACGCT
  sspABDS GATTGAAGCTTACTTCACAACGCGTAATGC
  hnsΔ92-1 GAGCTGCTGAATAGCCTTGCCGCCGTTAAATCTGGCACCAAAGCTAAACGTGCTTGTGTAGGCTGGAGCTGCTTCG
  hnsΔ92-2 GGTTTTAGTTTCGCCGTTTTCGTCAACGTAGCTATATTTTGCCGGACGCTTATGAATATCCTCCTTAGTTC
  hnsUS2 CCATGGAATTCACCATGAGCGAAGCACTTAAAATTCTGAACA
  hnsDS2 CCAGGTCTGCAGTTATTGCTTGATCAGGAAATCG
Plasmid construction lerUS2 GATTGGATCCGCTGCGACTGCGTTCGCTTGCT
  lerDS2 GATTGAAGCTTCCAGCTCAGTTATCGTTAT
Primer extension lerPE GCTTCCTGCTGTAGA
  LEE2PE GCTGCTTCCATTGATCTTTCTCC
  LEE3PE CAATTTCAACACGGTTATC
  LEE4PE CAGATGCGGGGTTTTGATTAAATTC
  LEE5PE CATTGGGATTATGACCAAGA
  mapPE GGACTAAACATGCTATAAACC
  grlRPE CCTTCCCCACAGGAGTCTTC
  stcEPE GGCAAGGATCGTACATGA
  ompAPE ACGAGATAACACGGTTAAATCC