Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: Characterization of EssB, a protein required for secretion of ESAT-6 like proteins in Staphylococcus aureus

Name Nucleotide sequence Usage
essB-attB1 -F GGGGACAAGTTTGTACAAAAAAGCAGGCTCATCTTAATGGTGATTTTAACTATG Cloning of the essB deletion mutant in pKOR1 for allelic replacement
essB -15codons-R AAAGATCTTAACATATCTTGCATTTCATTTTTAG Same as above
essB -15codons-F AAAGATCTCAAAAAGATAAAGAAAAACGCCAAG Same as above
essB-attB2 -R GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCAACCGTTGGATAATGGTAATTC Same as above
essB-Xho I-F AAACTCGAGATGGTTAAAAATCATAACCCTAAAAATGAA Gene expression in E. coli or S. aureus using pET15b or pWWW412, respectively
essB-BamH I-R AAAGGATCCCTATTTTTTTCTTTCAGCTTCTTGGCGTTT Same as above
essB(1–223)-BamH I-R AAAGGATCCCTACCCTACTTTGCGTACATATGCATAA Same as above
essB(253–444)-Nde I-F AAACATATGAAGCATAATGAGCGCATTGAAAAAG Same as above
essB(1–252)- BamH I-R AAAGGATCCCTATACTGAAAAATATAAAAAGGCTAAAAAT Same as above
essB(220–444)-Nde I-F AAACATATGCGCAAAGTAGGGCATACCGTTTTCAAA Same as above
essB (Δ224-252)- EcoR I-F AAAGAATTCATGAAGCATAATGAGCGCATTGAAAAAG Same as above
essB (Δ224-252)- EcoR I-R AAAGAATTCTCATGGGTTCACCCTATCAAGCCCTTGCTT Same as above
essB-BamH I-F AAAGGATCCATGGTTAAAAATCATAACCCTAAAAAT Production of GST hybrids using pGEX-2TK
essB-EcoR I-R AAAGAATTCCTATTTTTTTCTTTCAGCTTCTTGGCGT Same as above
essB(1–223)-EcoR I-R AAAGAATTCCTACCCTACTTTGCGTACATATGCATAA Same as above
essB(253–444)-BamH I-F AAAGGAATCATGAAGCATAATGAGCGCATTGAAAAAG Same as above