Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: Tyrosine-containing peptides are precursors of tyramine produced by Lactobacillus plantarum strain IR BL0076 isolated from wine

Primer name Gene function Primer sequence Product size (bp) Source
tyrSa tyrosil-tRNA synthetase GTACGGATACGGACGCACAA 3815 This work
nhaCa antiporter Na+/H+ CCTAGTGAAAAATGGACAGC
tdcf tyrosine decarboxylase CAAATGGAAGAAGAAGTTGG 1761 [55]
tyrPLpR tyrosine/tyramine transporter TAGTTCCCAACTCACCAGAAA This work
tdcBF tyrosine decarboxylase GCCTTAGAAAGTATTATTCG 118 This work
tdcBR AGCGACAATCTTATCAATGC
tyrPLpF tyrosine/tyramine transporter TATGATTGCCACCGTTCGTTC 128 This work
tyrPLpR TAGTTCCCAACTCACCAGAAA
ldhD (Forward primer) dehydrogenase ATCGGTACTGGTCGGATTGG 123 [56]
ldhD (Reverse primer) GGTGTCAACGTACATGCCTTC
gyrA (Forward primer) gyrase GTTCGTCTCATGCGGTTAGG 85 [56]
gyrA (Reverse primer) AACTGGTGCCTCAGTCGTTG