Skip to main content

Table 2 Primer sequences

From: sigE facilitates the adaptation of Bordetella bronchiseptica to stress conditions and lethal infection in immunocompromised mice

Primer name Sequence (5´ - 3´) Source or Reference
SigEF GGCGGAGAATTCAGGAGGAGGCGTCATGAGCGAACGCGATG This work
SigER GGCCTAGGATCCTTACCAGCGACGCTCGGCAT This work
HisSigEF GGCCTGGCATATGAGCGAACGCGATGTCGA This work
HisSigER GGCCTAGGATCCTTACCAGCGACGCTCGGCAT This work
72SigEF GCGCGGTCTAGAAGGAGGAGGCGTCATGAGCGAACGCGATG This work
72SigER GCCCGGCTCGAGTTACCAGCGACGCTCGGCAT This work
72ChlorF GCGGCGGGATCCTGTGTAGGCTGGAGCTGCTTC [67]
72ChlorR GCCGCCGGATCCCATATGAATATCCTCCTTA [67]
SigEKO_LeftF GGGAATTCAAGATCGAGATCGGCCTGTCGAAT This work
SigEKO_LeftR AGGGATCCGAAGGCTTTCTTGTCGCCACGTTGTA This work
SigEKO_RightF AGGGATCCTGGTAAGGAGTGGCAGTCATGCAA This work
SigEKO_RightR GCGAATTCAAAGCAACGGTGTCATCAACGTCC This work
PFamF GGGCGGGAATTCTGCCGTTCGTGGATGTCCAG This work
PFamR GGGCGGAAGCTTGGGCCAACGAACTACTGGGT This work