Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Zinc–induced envelope stress diminishes type III secretion in enteropathogenic Escherichia coli

Primer Sequence 5’ - 3’ Strand Target Reference
K1153 CCGGAATTCTGCCGATGGCACCAGACA + LEE4 [14]
K1150 CGCGGATCCTGCCAAACATCGCCAAAGTAG LEE4 [14]